The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA triplets encoding the translation initiation (or start) codon and a stop codon are included in the sequence. 3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5' 5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3' a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine the amino acid sequence of the polypeptide (use three letter codes for the amino acids) and identify the N- and C- terminal ends of the polypeptide.

Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter9: Gene Expression And Gene Regulation
Section: Chapter Questions
Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...
icon
Related questions
Question

The following segment of DNA in a hypothetical model organism encodes a polypeptide containing
SEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA triplets
encoding the translation initiation (or start) codon and a stop codon are included in the sequence.
3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'
5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'
a. Label which of the DNA strands is the template strand and which is coding strand. 
b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine the
amino acid sequence of the polypeptide (use three letter codes for the amino acids) and
identify the N- and C- terminal ends of the polypeptide.

please help. I am confused. 

c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules
(like water)? Place a circle around these.
d. Some amino acids on a polypeptide can be modified post-translationally. These
modifications may have some effect on the function of the protein. State three modifications
that can occur and explain the effect of that modification on the protein.

Expert Solution
steps

Step by step

Solved in 2 steps

Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
Biology Today and Tomorrow without Physiology (Mi…
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning