Related questions
Concept explainers
Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E. coli BL21(DE3) cells are transformed with the pET-28a-OXA-M290 plasmid, and the transformed cells are grown on an agar plate that contains kanamycin.
The E. coli BL21(DE3) cells transformed with the pET-28a-OXA-M290 vector are next grown in liquid growth media that contains kanamycin. Once the culture reaches an OD600 of 0.6, isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 0.5 mM to induce protein production.
How does the addition of IPTG result in the transcription of genes that are regulated by the T7 promoter in E. coli BL21(DE3) cells? [4 – 6 sentences suggested]
For Context ONLY:
For this biology course and based on the results obtained from a previous BLAST search, the bacteria responsible for the infection at a Hospital is most likely a new strain of Escherichia coli. This strain is given the name E. coli AFB.
Earlier, BLAST was used to study a resistance gene from E. coli AFB. These analyses suggest that this strain produces a new β-lactamase, which is given the name OXA-M290. Also, primers were designed to amplify the gene encoding OXA-M290 by PCR.
The next step is to clone the PCR-amplified OXA-M290 gene into an expression vector, so that recombinant OXA-M290 protein can be produced and studied. You will start by going over the process of cloning the OXA-M290 gene into pET-28a. Be sure to reference a plasmid map for pET-28a.
Here is the
>OXA-M290
ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT
ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT
TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG
CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA
CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC
AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC
CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG
AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG
CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG
AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG
GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG
GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG
TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG
CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA
TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT
GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG
GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA
CAGGAAAAAATTATTCCCTAG
Step by stepSolved in 3 steps
- Can you give an example of a modified (tagged) primers to amplify E. coli UidA sequence and subclone into appropriate vector (pUC19)?arrow_forwardClone number in this case is number 196 which is shown in the images. State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)arrow_forwardUsing the Figure below briefly describe how the amplification can be used in the cloning process of DNA.arrow_forward
- Explain the process of how X-gal screening works with pUC19, you may build a model with boxes and arrows. 2. You are utilizing BamHI (GGATCC) restriction site and HindIII (AAGCTT) restriction site. Within pUC19, BamHI is at position 263, while HindIII is at position 233. (Hint: position is like coordinate on a map). If you manage to insert GTF2H5 in pUC19 vector, what are the sizes of fragments if you digest the pUC19-GTF2H5 (this is after insertion) with the following restriction enzyme combination after gel electrophoresis: BamHI and HindIII There is an NdeI site right in the middle of the GTF2H5 that has been inserted in pUC19, what would be the fragment sizes, if you digest with BamHI and NdeI. HindIII and NdeI BamHI, HindIII, and NdeI. 3. Design an experiment to confirm the presence of insert GTF2H5 in pUC19 vector using the following method (besides restriction analysis above), assuming that you know the sequence of GTF2H5: Southern Blot Polymerase Chain Reactionarrow_forwardA sample of E.coli cells is transformed with a plasmid containing a transcriptional fusion including the promoter of an E.coli housekeeping gene and the LacZ gene. The transformed cells are plated out on selective medium containing X-gal. Which of the following best describes the likely results. a. Colonies will only be blue if lactose is also included in the growth medium. b. Colonies will only be blue if lactose and glucose are included in the growth medium c. Most of the colonies should turn blue. d. Presence of any white colonies may indicate deletion or mutation of the promoter. e. Both c. and d. are correctarrow_forwardThe following table lists 4 bacterial strains that are partial diploids for lac operon genes. Given the activity of beta-galactosidase measured for each strain in the absence (-lac) or presence (+lac) of lactose, complete the table by choosing the appropriate symbol (+, -, C, S) to indicate the allele of the gene or site missing from the table (blue numbers). strain A BC 5 C D 7 chromosome I O 1 2 4 1 [Select] 9 3 [Select] [Select] [Select] 9 [Select] + + Z + + 6 + I +5 + 10 plasmid O 3 + 7 C Z + 8 8 2 [Select] 4 [Select] 6 [Select] B-gal act. -lac +lac 0.002 0.003 0.002 0.058 0.063 0.121 0.059 0.062 Select] 1 ✔ [ Select] + is C Sarrow_forward
- A plasmid contains genes for ampicillin resistance and chloramphenicol resistance and has single sites for Hind III and Eco RI. When genes are inserted into the Eco RI site, transformants are resistant only to ampicillin. In which region is the site for EcoRI located? Group of answer choices within the chloramphenicol gene between the ampicillin and chloramphenicol genes can't be determined within the ampicillin genearrow_forwardAssume you have successfully cloned a small (200 bp) fragment of DNA into the polylinker region of a pUC18 cloning vector. Describe the appearance of transformed colonies you would expect to see on each of the following plates: plain media, media containing ampicillin, media containing tetracycline, media containing ampicillin and X-Gal.arrow_forwardTo determine if the antibiotic resistance in MH1 was carried on a plasmid, you first isolate the plasmid in MH1 using the plasmid DNA purification technique. Then, you transform bacteria that are not resistant to penicillin/ampicillin with the plasmid isolated from MH1. For the bacterial transformation experiment, you set up the three controls listed below. Match each control with its appropriate purpose (i.e. what it is controlling for) Please note: Transformed bacteria are bacteria that received the plasmid from MH1 and untransformed bacteria are bacteria that did not receive a plasmid. Testing to ensure that the bacteria used in the transformation experiment are viable (i.e. can grow on LB media) (Choose) [ Choose ) after transformation. Untransformed bacteria plated on LB only plate Testing to ensure that the bacteria used in the transformation experiment are viable (ie. can grow on LB media) before transformation. Transformed bacteria plated on LB only plate Untransformed bacteria…arrow_forward
- You are a graduate student working to construct a single gene knockout library of Leptospiria kirschneri, one the causative agents of leptospirosis. You are looking for single gene mutants which disrupt the bacterium’s spirillum shape to determine what role this rare cellular morphology may play in disease development and progression. Using an appropriate donor strain, you introduce the plasmid shown into L. kirschneri. L. kirschneri is not able to replicate the plasmid. The repeat regions are denoted on the plasmid map as vertical black lines, the transposase is denoted as tnp, and kanamycin kinase is denoted as aph. The larger of the two regions is transposed. Following selection and counter-selection, you isolate several non-spirillum colonies, which you use to infect juvenile piglets. Most of the infected piglets develop leptospirosis. Isolating L. kirschneri from these animals reveals that it has regained its spirillum morphology. What is a likely explanation for this reversion of…arrow_forwardA plasmid has been modified such that it carries the gene for beta-galactosidase (lacZ) under the control of the lac promoter. Between the lac promoter and the lacZ gene is an empty multiple cloning site (MSC). This plasmid also carries ampicillin resistance. E. coli are transformed with this plasmid, and grown on nutrient agar containing ampicillin, IPTG, and the lactose analogue Xgal for 18 hours. Following incubation, the plates are examined. What will be the likely colour of the bacteria colonies?arrow_forwardYou are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting the DF508 –CFTR mutation. The vector uses CRISPR –CAS9 genome editing to correct the mutated gene in situ (CFTR-CRISPR). An Ussing chamber experiment was performed using nasal airway cells obtained from a patient with the DF508 CFTR mutation which were transformed with either a control vector consisting of an inert CRISPR-CAS-9 construct (CONTROL) or the active, gene correcting CRISPR CAS-9 construct (CFTR-CRISPR). The following transepithelial voltage values were obtained for the drug regimen shown under open circuit and current clamp (injected current of 10mA) conditions: CONTROL Baseline Amiloride Forskolin Inh172 Vte (mV) -78 -2 -4 -3 DVRt (mV) 8 16 7.5 13 R (W.cm-2) 800 1600 750 1300 I (mA.cm-2) 98 1 5 2 CFTR-CRISPR Vte (mV) -38 -6 -23 -9 DVRt (mV) 9 27 6 11 R (W.cm-2) 900 2700 600…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education, 
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education