Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 8RQ
The -10 and -35 regions of prokaryotic promoters are called consensus sequences because.__________
- they are identical in all bacterial species
- they are similar in all bacterial species
- they exist in all organisms
- they have the same function in all organisms
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
What is the Shine-Dalgarno sequence?
Question 15 options:
A consensus sequence in prokaryotic promoters
A consensus sequence in eukaryotic promoters
A consensus sequence in eukaryotic enhancers
A consensus sequence in prokaryotic mRNA that binds to rRNA
A consensus sequence in eukaryotic mRNA that binds to rRNA
All of the following are needed for capping of eukaryotic mRNA, EXCEPT
Question 27 options:
Guanylytransferase
S-AdoMet
RNA 5'-triphosphatase
Adenosyl-transferase
Methyl-transferase
The eukaryotic metallothionein gene promoter consists of all EXCEPT:
MRE
GC Box
Pribnow box
GRE
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
(a) A car speedometer has a 5.0% uncertainty. What is the range of possible speeds when it reads 90 km/h? (b) C...
College Physics
CAUTION Why does the presence of extinct forms and transitional features in the fossil record support the patte...
Biological Science
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (5th Edition)
MAKE CONNECTIONS Using what you know of gene expression in a cell, explain what causes the traits of parents (...
Campbell Biology (11th Edition)
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
Explain why genetic Variation within a population is a prerequisite for evolution.
Campbell Biology (10th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material must be replicated with high fidelity and great speed. Eukaryotic mRNA is said to be polycistronic since they encode multiple polypeptide chains RNA-synthesis occurs inside the nucleus while protein synthesis in the cytoplasm of eukaryotic organisms. Write T if the statement is true and write F if the statement is falsearrow_forwardAll of the following are involved in initiation of protein translation in prokaryotes, EXCEPT Question 41 options: IF1 GTP IF3 Rho factor IF2arrow_forwardA eukaryotic gene typically has all of the following features except O A5' UTR An operator A promoter Transcription factor binding sites Intronsarrow_forward
- EIF stands for eukaryotic initiation factors and they are part of the pre-initiation complex needed to bind with the ribosome. true or falsearrow_forwardA _____________ is a purine-rich sequence in close proximity to AUG on a prokaryotic mRNA that binds to a complementary sequence on the 30S ribosome subunits, thereby promoting the formation of the correct preinitiation complex.arrow_forwardThis question refers to the mRNA sequence below: 5-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3" As this mRNA is translated, the fifth codon is Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.arrow_forward
- Match the correct answer to each blank. Note that each answer (1 through 4) can be used more than once Eukaryotic mRNAs Prokaryotic mRNAs Transfer RNAs Ribosomal RNAs 1. They are capped on their 5’ ends and polyadenylated on their 3’ ends 2. They contain unusual or modified nitrogenous bases 3. There are 4 types of these in eukaryotes and only 3 types in E. coli 4. They contain intronsarrow_forwardThe following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNAarrow_forwardThis question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.arrow_forward
- Some eukaryotic promoters contain an element positioned around nucleotide +1 called a transcriptional initiator (INR) sequence. * True falsearrow_forwardThe process in which the two-dimensional structure of RNA from the L region of an operon can either prevent or allow transcription of the structural genes is called _____________. Group of answer choices Activation Co-repression Induction Attenuation Repressionarrow_forwardYou may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license