Biology 2e
Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 15, Problem 21CTQ

A scientist sequencing itiRNA identifies the following strand:

CUAUGUGUCGUAACAGCCGAUGACCCG

What is the sequence of the amino acid chain this itiRNA makes when it is translated?

Blurred answer
Students have asked these similar questions
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene.                123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3   a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write the DNA sequence of the mutant gene (Both DNA strands)  c. Write the sequence of mRNA produced from the mutant gene  d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated? The genetic code has been provided for you below. Second letter U C A G UAU UACJ UAA Stop UGA Stop A UAG Stop UGG Trp UCU ) UUU) Phe UUC J UGU U UCC UGC, U UUA LE Ser UCA -Leu UUG, UCG CAU САС His CAA CAG Gln CUU CCU CGU CGC Arg CỤC ССС Leu -Pro CỦA ССА CGA CUG СCG CGG AAC FAS AAGLYS AUU ACU AAU AGU Asn Ser AUC ile AUA AUG Met| ACG AGC AGA Arg AGG J АСС - Thr АСА AAA GAU Asp GACJ Ala GAA GUU GCU GGU U GUC Val GUA GGC Gly GGA GCC GCA GAG Glu GGG GUG GCG First letter Third letter
a) Replicate this sense strand to create a double-stranded DNA helix  TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT   b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR:    3’ UTR:

Chapter 15 Solutions

Biology 2e

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY