Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 19CTQ
Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
How many codons would exist in a genetic code that had codons that were four bases long? Why? (show the equation for calculation)
During planetary exploration a new life form is discovered which has a DNA genome containing 6 different bases rather than the familiar four. The life form contains proteins with 25 different amino acids. Codons on Earth comprise three nucleotides; assuming a non-overlapping genetic code that includes initiation and termination codons, how many nucleotides would you predict to constitute a codon in the new life form, assuming all codons to be the same length? Briefly explain your answer
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’
1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
A seagull flies at a velocity of 9.00 m/s straight into the wind. (a) If it takes the bird 20.0 min to travel 6...
College Physics
When you rub your cold hands together, the friction between them results in heat that warms your hands. Why doe...
Anatomy & Physiology (6th Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
Body, Heal Thyself The precision of mitotic cell division is essential for repairing damaged tissues like those...
Biology: Life on Earth with Physiology (11th Edition)
Raw Oysters and Antacids: A Deadly Mix? The highly acidic environment of the stomach kills most bacteria before...
Microbiology with Diseases by Body System (4th Edition)
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?arrow_forwardThe genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.arrow_forwardDNA A G T A C C G G G C A A A C T G C A T T G T G mRNA U C A U G G C C C G U U U G A C G U A A C A C Use the "Genetic Code Chart" to determine the sequence of amino acids in your polypeptide chain. Remember to START translation at the start codon by adding a Methionine and STOP translating when you reach a stop codon.arrow_forward
- Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: Checkarrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forwardThe sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEarrow_forward
- Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forwardNow we need to know which amino acid the tRNA is carrying. We can do this on paper using the GeneticDictionary below. Starting with the 1st base in the codon, pick the row. Then use the 2nd to pick the column,the use the 3rd to pick the line. There you will find an abbreviation of the name of the amino acid (AA).Write that abbreviation in the AA (short) box next to the appropriate anti-codon. Use the list below tofind the full name of the amino acid and list that in the AA (full name) box. Remember to translate themRNA codons and not tRNA!Notice that there is only one START codon and a few STOP codons. Go ahead and finish the strand evenif it doesn’t start with Met. Why do you think there is only one START? Why do you think there might be more than one STOP?GENETIC DICTIONARY U C A G U Phe Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP STOP Cys Cys Stop Trp U C A G C Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg U C A G A Ile Ile Ile…arrow_forwardWhat does it mean when we say that the genetic code contains degeneracy? Discuss the universality of the genetic code.arrow_forward
- The codons in the genetic code are sequences of three bases. Explain why sequences of only two bases could not be used to code for the 20 different amino acids commonly found in proteins.arrow_forwardCodons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?arrow_forwardhow many codons would exist in a genetic code that was four bases long (instead of three)? DRAW and Show your work.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY