Answered: Some eukaryotic promoters contain an…

Name: Some eukaryotic promoters contain an element positioned aroundnucleot
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Some eukaryotic promoters contain an element positioned aroundnucleotide +1 called a transcriptional initiator (INR) sequence. *Truefalse

Science

Biology

Some eukaryotic promoters contain an element positioned around nucleotide +1 called a transcriptional initiator (INR) sequence. * True false

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SA: Put the following processes in order of their occurrence during expression of a eukaryotic gene: a....

See similar textbooks

Related questions

Q: The common energy currency molecule in any cell is: Select one: ADP glycogen охудen АТР

A: Cellular respiration is a process that takes place in aerobic organisms (aerobic respiration) in…

Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the RNA for…

A: Post transcriptional modification It is a biological process in eukaryotic cell where primary…

Q: All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the…

A: The process by which introns are removed from heterogeneous nuclear RNA to form mRNA is called…

Q: What did genera discussed the Enterococcus? Are the healthcare concerns, infections, and nosocomial…

A: DISCLAIMER "Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: T or F. Motor signals originating in the cortex can't interfere with motor reflex response? T or F.…

A: 1) the correct answer is - TRUE but it has restrictions upto a limit. This statement is neither…

Q: Which of the following RNAS is the product of transcription?

A: Transcription is the process of making an RNA copy of a gene sequence

Q: Which series is arranged in order from largest to smallest? Chromosomes, nucleus, cell, DNA,…

A: Introduction The cell is the smallest unit that can live on its own and that makes up all living…

Q: Explain the variation in diameter of skeletal muscle fibers and what type of muscle tissue undergoes…

A: Introduction Muscle fibers consist of elongated cells or a single muscle cell from 0.02 to 0.08 mm…

Q: What component of the extracellular environment is required for the homophilic interactions mediated…

A: Cadherin is a type of adhesion molecule that exists within cells. Cadherin is found almost…

Q: Consider the following statements and indicate whether each presents an idea of Jean-Baptiste…

A: The evolution is the change in the characteristics of a species over several generations. It mainly…

Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…

A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…

Q: Anatomical structures that share a common ancestry are called __________structures. *

A: This question is based on homologous and analogues structure.

Q: b. What is the average charge of the amino acid at a pH of 10? Please round your answer to the…

A: The isoelectric point is the point at which amino acids carry no net charge.

Q: Compare the mechanisms and accuracy of auditory localizationof a sound source in a human, an owl,…

A: The ability to analyse the direction from which a sound is originating is called sound localization.…

Q: scientists would call this ecosphere a “closed system” because it is sealed from the outside world.…

A: Closed system is a physical system in which there is no transfer of matter or energy outside the…

Q: What are MHC class I and class II receptors and how do they recognize foreignness

Q: In discussions of feedback in biological systems, negativefeedback is typically emphasized, and…

A: A negative feedback system is one in which the change is opposed so that homeostasis is retained

Q: Discuss the eukaryotic transcription process and mention the enzymes and components needed in the…

A: Cell is the basic structural and functional unit of life. All cells contains nucleus within which…

Q: Instructions: Answer the following problem using the punett square and identify its Genotypic ratio…

A: Phenotype: A phenotype is a set of observable features or attributes of an organism in genetics.…

Q: Vhich of the following are required to set up a CRISPR-Cas9 experiment to fix a mutation in a gene…

A: CRISPR or Clustered regularly interspaced short palindromic repeats is a gene editing technique in…

Q: Patients with sever ly reduced C3 levels tend to have а. Increased number of severe viral infections…

A: C3 means complement component is a protein present in the immune system. It is important for innate…

Q: Adult Karner blue butterflies: A Feed on a variety of nectar producing flowers. B Do not feed. C…

A: Anatomy, which reveals that evolutionary ties may be proven through homologous structures, and…

Q: Virology:What is the Baltimore classification of influenza viruses and what does this mean

A: Introduction :- Because viruses lack a comprehensive mechanism for protein translation, they rely on…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: 1) DNA Sequence: THE BOY CUT HIS LIP AND ARE THE HOT DOG Insertion: THE BOY CCU THI SLI PAN DAR ETH…

Q: Why is it difficult to show vesicular release of neurotransmittermolecules by electron microscopy?

A: A microscope is a device used to examine microscopic organisms that are invisible to the naked eye.…

Q: rationale for synthesizing and rapidly degrading p53 protein

A: p53 protein synthesised byTP53 (tumour protein 53) is a 393 amino acids long protein and is known…

Q: Brief history of cotton plant in human society

A: Land plants come under the category of multicellular creatures that have a variety of properties…

Q: Provide current Prevalence data on Diabetes linking it too type 2 Diabetes

A: Diabetes is the condition which affects the body processes blood glucose, In type 2 diabetes Body…

Q: The Theory of Use and Disuse suggests that an organism’s body part may develop or disappear…

A: The evolution of organisms depends on several factors. The study of evolution mainly based on…

Q: When does DNA replication occu after the cell divides O before protein synthesis O during cell…

A: Cell cycle is the series of cell division that takes place in a cell as it grows and divides. Cell…

Q: What is required to form a phosphodiester bond withanother nucleotide ?

A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…

Q: READ THIS: Notice that natural selection does not refer to indiv Trequency of adaptive heritable…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: A

A: Introduction Muscles are soft tissues that contract to produce a particular movement, fascicles are…

Q: Which of the following statements describe convergent evolution? *

A: This question is based on convergent evolution.

Q: xamine the pedigree. If individual I-1 is a carrier for the Robertsonian translocation leading to…

A: Down syndrome is characterised by a combination of phenotypic features that include mental…

Q: To fight infection, leukocytes move rapidly from the blood into sites of infection in the tissues.…

A: The process of inflammation begins with tissue damage (such as due to injury or infection) followed…

Q: Parent Cross: Blue-Eyed Male x Normal Female Blue-Eyed Female F1 Offspring Normal Male Normal Female…

A: Drosophila melanogaster. The position of the white eye gene, positioned at the x-chromosome of this…

Q: give a cladogram with the following: dog, bird, fish, mango, and mahogany

A: cladogram is a diagram that depicts evolutionary relationships among groups. It is based on…

Q: 5. How are vestigial structures an example of evidence of evolution?

A: Here we describe the vestigial structures as an evidence of evolution.

Q: What are the major differences between male and female institutions and how are correctional…

A: Introduction A culture is a collection of a group's beliefs and customs, while society is a…

Q: What happened with the climate of Tanzania between 1960 and 1975?

A: Tanzania is an East African country. The climate is hot and humid throughout the year.

Q: According to evolutionists, which is the best test to show the relatedness of two organisms?

A: Evolution is the change in the characteristics of a species over several generations and relies on…

Q: A cell that is undergoing meiosis started 6 chromosomes. At the end of meiosis II: 1. How many…

A: We will answer the first three sub-parts for you. Please submit the question again by mentioning the…

Q: mortis, algor mortis, and livor mortis are characteristics that help the examiner determine an…

A: Rigor mortis, algor mortis, and livor mortis are the early signs of the postmortem. These are the…

Q: METABOLIC METABOLITES DISORDERS Alkaptonuria SYMPTOMS DIAGNOSIS Phenylketonuria Gout Ketosis Fatty…

A: Alkaptonuria and phenylketonuria are called inborn errors of metabolism. The disorders are usually…

Q: 1 2 3 4 5 6 7 8 ii %3| 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y The image has a non-disjunction…

A: The given image depicts the presence of an extra Y chromosome. The condition is 47XYY, called…

Q: 7 methylguanosine will be installed at the 5 terminus of MRNA during yeast transcription * True…

A: Capping is a process which is initiated after the transcription of DNA to mRNA is completed. The…

Q: Which among the model organisms used as an option for an inexpensive tool for genetic studies with…

A: Model organism is any species that is widely studied, usually because it is easy to maintain and…

Q: Provde real exmaples of Public health strategies and campains of the prevalence of diabetes.

A: Diabetes can be described as condition in which blood glucose or blood sugar, becomes too high in…

Q: What two properties define a stem cell? Distinguish between a totipotent stem cell, a pluripotent…

A: In the body, stem cells work as a repair system. Stem cells are cells having the ability to develop…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

Some eukaryotic promoters contain an element positioned around
nucleotide +1 called a transcriptional initiator (INR) sequence. *
True
false

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Defend or attack this statement: “All eukaryotic promoters have TATA boxes.”
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domain
The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.
A eukaryotic gene typically has all of the following features except O A5' UTR An operator A promoter Transcription factor binding sites Introns
The double stranded DNA sequence shown contains the promoter for the transcription of a bacterial gene. GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT Draw a box around each of the promoter elements and identify each. Identify which strand will be used as the template strand by putting a vertical line between the -1/+1 start site nucleotides and underlining in the direction of transcription on the template strand as the example below indicates. ATCGG\GAATCGC TAGCCCTTAGCG Give the sequence of the RNA created
Write out the sequences of the two conserved elements in the following bacterial promoter. The startpoint of transcription is shown in red. TGCTTGACTCTGTAGCGGGAAGGCGTATTATGCACACCGCG
Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleus
Assume that this DNA molecule is from a bacterial cell. Draw the approximate locations of the promoter and terminator for this transcription unit.
Describe the similarities and differences between prokaryotic and eukaryotic promoter sequences.
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.