Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4.3, Problem 3R
Summary Introduction
To review:
The importance of ribozymes in the establishment of ribonucleic acid (RNA) world hypothesis.
Introduction:
In order to decide which molecule first started life, few features were considered such as, the molecule should be able to translate, replicate, and show a catalytic behavior. Then RNA has the ability to maintain itself stable, undergo replication, the formation of functional product required for the process of translation, and at last, in order to carry out the above processes at an appreciable rate, the RNA molecule is able to show a catalytic behavior.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Given the following sequence for an RNA molecule, find a second-
ary structure that will be maximally stable.
GUCCAGCCAUUGCGUUCGCAAUGGC
Consider a short peptide that forms an alpha-helix within a larger protein structure. Suppose that one glutamate residue at some specific position in the helix were mutated to a leucine residue. The mutation could either make the helix more stable, or less stable.
i) Describe two situations in which a Glu-to-Leu mutation could make the helix more stable.
ii) Describe two situations in which the Glu-to-Leu mutation could make the helix less stable.
Explain briefly the basis for the stabilizing and destabilizing effect in all cases.
The synthesis of a peptide is given by the mRNA sequence 5'GAAGAGAAACUUACU3', Find the primary structure of this peptide. If, due to a transcription error, the fourth, eighth, and ninth nucleotides are omitted, what peptide would be synthesized? Find the charge of each peptide at pH7 and explain whether this transcription error can affect the biological activity of said molecule.
Chapter 4 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. b)Which of the 3 types of RNA might you expect to be the least stable? Why?arrow_forwardA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forwardWhat kind of bond is created between successive amino acids in a protein? If there are more codon combinations than amino acids available in biology, then why aren't amino acids encoded by two nucleotides for each codon instead of three? How does secondary and tertiary protein structure develop from the primary structure created during translation? The picture below is of translation happening in a cell in real time. How is this image different from the models we have made in this exercise? RNA Ribosomes A morphologists view of tramslation Polypeplide chaingarrow_forward
- Name the four classes of RNA and briefly explain their functional significance. In what reaction(s) do they participate?arrow_forwardConsider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are insertedarrow_forwardWhich of the following statements about translation is false? In eukaryotes, the 5' cap and the 3' poly(A) tail are involved in translation initiation. Peptidyl-transferase activity during translation is the property of a ribozyme. A base at the first position of an anticodon on the tRNA would pair with a base at the third position of the mRNA. The growing peptide chain is transferred from the tRNA in the P site to the tRNA in the A site. Ribosomes move along an mRNA in the 3’ → 5' direction.arrow_forward
- Why is RNA structure so unstable? Explain in detail.arrow_forwardFor the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?arrow_forwardChristian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high concentrations of beta mercaptoethanol (BME). When BME is removed, it restores only approximately 1% of RNase activity. When a very low concentration of BME is added back to RNase, its activity is restored to nearly 100%. Why? a Low concentrations of BME causes disulfide bonds to break, but they randomly reform. b High concentrations of BME disrupt all disulfide bonds, which inactivates the enzyme. At low concentrations all of the disulfide bonds reform and BME acts as a cofactor for the enzyme. c The enzyme is only active when an intermediate number of disulfide bonds exists. which is achieved only at low concentrations of BME. d The low concentration of BME allows the majority of the proteins to adopt their most stable form, which is the active form.arrow_forward
- Explain how a peptide bond is formed in translation elongation in terms of: a) Which enzyme catalyzes it b) Where is occurs at the ribosome (EPA sites?) c) What kind of a chemical reaction it is.arrow_forwardWhat enzyme catalyzes protein synthesis in bacteria? You discover a new broad-spectrum antibiotic that inhibits protein synthesis and named it Compound J. You want to determine the mechanism of action of Compound J. After treating bacteria cells with Compound J, you observe many ribosomes with long polypeptide chains bound to them. Based on this observation, make a hypothesis about which part of the ribosome Compound J is binding and how this specifically affects translation. What evidence supports that proper protein folding is essential to all domains of life? Name and describe the function/s of two specific molecules that help proteins fold in bacteria.arrow_forwardWhich is/are NOT true of protein isoforms? They are related in structure and function. B) They have identical base sequence. (c) they are the result of alternative splicing They have variable amino acid sequencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license