Life: The Science of Biology
Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
Question
Book Icon
Chapter 4, Problem 2Q
Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms


Organism and the tissue from which RNA is extracted
The composition of RNA base (%)
Adenine Guanine Cytosine Uracil
Rat liver 19.2 28.5 27.5 24.8
Carp muscle 16.4 34.4 31.1 18.1
Yeast 25.1 30.2 20.1 24.6
Rabbit liver 25.1 30.2 20.1 24.6
Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Blurred answer
Students have asked these similar questions
Why is RNA structure so unstable? Explain in detail.
Given the following sequence for an RNA molecule, find a second- ary structure that will be maximally stable. GUCCAGCCAUUGCGUUCGCAAUGGC
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing?  Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education