Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4.1, Problem 3R
Summary Introduction
To review:
Specificity and range of aptamers for binding the target molecules.
Introduction:
Aptamers are small single-stranded molecules, which are similar to
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
We have been told that some tumours in the colon are associated with
microsatellite instability. What does this mean?
A number of yeast-derived elements were added to thecircular bacterial plasmid pBR322. Yeast that requireuracil for growth (Ura− cells) were transformed withthese modified plasmids and Ura+ colonies were selected by growth in media lacking uracil. For plasmidscontaining each of the elements listed in parts (a) to(c), indicate whether you expect the plasmid to integrate into a chromosome by recombination, or insteadwhether it is maintained separately as a plasmid. If theplasmid is maintained autonomously, is it stably inherited by all of the daughter cells of subsequent generations when you no longer select for Ura+ cells (that is,when you grow the yeast in media containing uracil)?a. URA+ geneb. URA+ gene, ARS c. URA+ gene, ARS, CEN (centromere)d. What would need to be added in order for these sequences to be maintained stably in yeast cells as alinear artificial chromosome?
Chapter 4 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example: Rifamycin inhibits prokaryotic RNA polymerase Chloramphenicol blocks the transfer of the peptide from the P to A site. a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible. b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)arrow_forwardIn what ways does the double helix explain the essential properties of a gene? What are Chargaff’s rules? Phage T2 is estimated to consist of about 200,000 deoxyribonucleotides pairs. Give the length in micrometer of its DNA complement.arrow_forwardDuring your experiment you analysed only a few of the recombinant clones for the presence of thehighly repeated Alu elements. If you wanted to screen for a single-copy gene, you would need to screenall of a much larger genomic library. Assuming, that you already know the amino acid sequence ofunicorn (a species with a similar physiology to humans) insulin, how would you construct a probe whichwould enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for theinsulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors,enzymes, and DNA sequencers.arrow_forward
- The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?arrow_forwardWhat is the cotransduction coefficient of histidine and valine? For consistency, standardize on histidine. In E. coli, the genes for histidine (his), arginine (arg), tyrosine (tyr), and valine (val) synthesis are closely linked. A wild-type strain is used as a donor for transducing viruses. Various recipient strains were treated with these viruses. Wild-type recombinant colonies were then counted, with the results shown in the following table. Genotype of recipient Number of wild-type colonies Genotype of recipient Number of wild-type colonies his- arg+ val+ tyr+ 254 his+ arg- val- tyr+ 132 his+ arg+ val- tyr- 36 his+ arg- val+ tyr+ 240 his- arg- val+ tyr+ 28 his- arg+ val- tyr+ 102 his- arg+ val+ tyr- 100 his+ arg- val+ tyr- 2 What is the cotransduction coefficient of histidine and valine? For consistency, standardize on histidine. 0.38 0.537 0.402 None of thesearrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forward
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardConsider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structurearrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forward
- How can the binding assay technique be used to assign coding triplets to the corresponding amino acids?arrow_forwardAn investigator was interested in studying UAG nonsense suppressor mutations in bacteria. In one speciesof bacteria, she was able to select two different mutants of this type, one in a tRNATyr gene and the otherin a tRNAGln gene, but in a second species, she wasnot able to obtain any such nonsense suppressor mutations, even after very extensive effort. What couldexplain the difference between the two species?arrow_forwardWhat type of DNA structure is recognized by RecG and RuvABC?Do you think these proteins recognize DNA sequences? Be specificabout what type(s) of molecular recognition these proteins canperform.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License