Biology
Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 4.3, Problem 1CS
Summary Introduction

To explain:  The effects of alternative splicing on protein structure and function.

Introduction: Precursor mRNA is converted into mRNA through a method called splicing. Alternative splicing is a method of RNA regulation in which splicing occurs in more than one way to produce two or more different polypeptides. Production of two or more polypeptides from a single gene results in a reduction of the size of genome and increase in the size of proteome which can be beneficial.

Blurred answer
Students have asked these similar questions
try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________
Q1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations on phage R17 coat gene and replicase gene translation and explain the logic of your answers: a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon. b. Mutations in the stem loop around the coat gene initiation codon that weakens the base-pairing in the stem loop. c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.
So let’s review what we just did with a few questions:  What are the different types of RNA used and what are their roles?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Biology (MindTap Course List)
    Biology
    ISBN:9781337392938
    Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
    Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY