Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4.3, Problem 1CS
Summary Introduction
To explain: The effects of alternative splicing on protein structure and function.
Introduction: Precursor mRNA is converted into mRNA through a method called splicing. Alternative splicing is a method of RNA regulation in which splicing occurs in more than one way to produce two or more different polypeptides. Production of two or more polypeptides from a single gene results in a reduction of the size of genome and increase in the size of proteome which can be beneficial.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
try w1
II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA
mRNA: _________________________
Amino acids: _____________________
2. ACTACTTTCAGAGCTATATTCAG
mRNA: _________________________
Amino acids: _____________________
Q1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations on phage R17 coat gene and replicase gene translation and explain the logic of your answers:
a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon.
b. Mutations in the stem loop around the coat gene initiation codon that weakens the base-pairing in the stem loop.
c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.
So let’s review what we just did with a few questions:
What are the different types of RNA used and what are their roles?
Chapter 4 Solutions
Biology
Ch. 4.1 - What properties of deep-sea vents made them...Ch. 4.1 - Which protobiont seems most similar to todays...Ch. 4.1 - Core Skill: Connections Look back at Figure 3.11....Ch. 4.1 - Prob. 3CCCh. 4.2 - Prob. 1CCCh. 4.2 - Prob. 2CCCh. 4.3 - Prob. 1CSCh. 4.3 - Prob. 1CCCh. 4.3 - Prob. 2CSCh. 4.4 - Prob. 1CS
Ch. 4.4 - Describe the type of movements that occur between...Ch. 4.4 - Prob. 2CSCh. 4.5 - Prob. 1CCCh. 4.5 - Prob. 1CSCh. 4.5 - If we consider the Golgi apparatus as three...Ch. 4.5 - The Nucleus and Endomembrane System Experimental...Ch. 4.5 - Prob. 2EQCh. 4.5 - Prob. 3EQCh. 4.5 - Prob. 3CCCh. 4.6 - Prob. 1CCCh. 4.6 - Core Skill: Connections Look ahead to Figure...Ch. 4.7 - Prob. 1CCCh. 4.7 - Prob. 2CCCh. 4 - The cell theory states that a. all living things...Ch. 4 - Prob. 2TYCh. 4 - Prob. 3TYCh. 4 - Prob. 4TYCh. 4 - Each of the following is part of the endomembrane...Ch. 4 - Prob. 6TYCh. 4 - Functions of the smooth endoplasmic reticulum...Ch. 4 - Prob. 8TYCh. 4 - Prob. 9TYCh. 4 - Which of the following observations would not be...Ch. 4 - What are the four stages that led to the origin of...Ch. 4 - Explain how motor proteins and cytoskeletal...Ch. 4 - Prob. 3CQCh. 4 - Discuss the roles of the genome and proteome in...Ch. 4 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel syntheiss. You do not have a transcripome (RNA sequence). Outline a protocol for deducing the ORF and the protein sequence.arrow_forwardQ4. If you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will likely affect how much protein is made by translation of this message? A. The presence of appropriate snRNPs. B. The length of the polyA tail. C. The strength of hydrogen bonds holding the mRNA to ribosomal RNA. D. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.arrow_forwardQ. When dsRNA is treated with Dicer enzyme siRNA and miRNA’s are produced. What role they will play in gene regulation and expression and how? (Subject Bioinformatics)arrow_forward
- Q.Consider this problem: You are working in the lab to study the pattern of paralysis and candidate genes involved in this process. You revealed that homozygous mutation in the SLB gene is the main cause of paralysis. The following sequence of SLB gene at the beginning of the translated region is found in individuals without paralysis. 5‟-GTA GCA TTT AAG CTT CAG TCC AAG - 3‟ (Met Thr Phe Glu Ile Gln Ser Arg). This sequence is however changed to the following sequence in affected individuals 5‟- GTA GCA TTT AAG CTT TAG TCC AAG - 3‟ (Met Thr Phe Glu Ile STOP). What mutation you will identify from this observation? Explain with reason. After identifying mutation if there is any, enlist all the possible repair mechanisms that can be helpful to repair the current situation. Elaborate your answer with that why you think that your suggested repair pathway should be used and how it can be effective for repairing in the current scenario?arrow_forwardWHAT IF? What would be the effect of treating cellswith an agent that removed the cap from mRNAs?arrow_forwardVISUAL SKILLS A segment in the middle of an mRNA has thesequence 5¿-AGAGAACCGCGA-3¿. Using the codon table, translate thissequence, assuming the first three nucleotides are a codon.arrow_forward
- Reflect on this "Gene therapy is still in its infancy, but its believe that as it matures, it will become an effective treatment for the myriad of genetic diseases that effect humanity ?arrow_forwardGive typed full explanation there are about 28,000 copies of zinc finger domains in the human genome, most of them as constituents of transcribed genes. This is a result of what process? Retro transposition of mobile sequences Evolutionary conservation, exon duplication and exon shuffling Evolutionary conversion of leucine zipper, helix-turn-helix, and helix-loop-helix domains into zinc finger domains Evolutionary selection for proteins that interfere with nucleosome packing Genes that “jump” with the help of a transposase.arrow_forwardQ1: In your own words, define RNA splicing. When during gene expression does it occur? Q2: What do you predict would happen if the introns were not removed from RNA before translation? Why would it be a problem if the introns were not removed? Q3: Where is the mRNA destined to go once it has been transported out of the nucleus?arrow_forward
- INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Transfer RNA is the RNA that contains anticodon STAMENT 2: The tail added to an mRNA to protect it from nuclease digestion is polyA tail ANSWER: STAMENT 1: Heterogenous RNA is a term that refers to mRNA that has not been processed STAMENT 2: If the %A of a bacteria is 20%, the amount of guanine is 30% ANSWER: STAMENT 1: A frameshift mutation involves a change in the reading frame used in the translation of an mRNA STAMENT 2: The genetic code is specific because each codon specifies only for one amino acid ANSWER:arrow_forwardQ9. Using the section of the genetic code below, identify the sequence of mRNA that would code for the polypeptide sequence of Pro-His-Arg. A. 5’CCACACCGA3’ B. 5’GGUGUUGCC3’ C. 5’GGAGUAGCA3’ D. 5’CCTCTCCGT3’arrow_forwardVISUAL SKILLS Describe what happens to the trp operon as the cell usesup its store of tryptophanarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY