Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 3AQ
What would be the result (in terms of protein synthesis) if RNA polymerase initiated transcription one base upstream of its normal starting point? Why? By inspecting Table 4.4, discuss how the genetic code has evolved to help minimize the impact of mutations.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You may wish to consult the genetic code above to answer the following question. A mutation has
changed a portion of a protein coding gene that encodes a messenger RNA sequence.
The original messenger RNA sequence is 5-AUGCCCAGAGCU-3'
Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the
encoded protein?
O 5-AUGCCCAGGGCC-3'
O 5'-AUGCCCUGAGCU-3'
O 5'-AUGCCCACAGCU-3
5'-AUGCCCCAGAGCU-3
Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA?
Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls.
What happens to protein synthesis if a nonsense codon is inserted into the gene?
Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations)
Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
This is a list of molecular changes that could happen during DNA replication, transcription, mRNA processing, or translation. For each, determine whether or not the change will be passed down through generations of cells after it occurs. Explain your answer.
C->G point mutation in the DNA of a coding region of a gene
A->T point mutation in the noncoding region of a gene
An error in transcription changes the mRNA sequence such that what was an amino acid-coding codon in the DNA sequence is now a stop codon in the mRNA sequence.
An error in translation causes the amino acid alanine (nonpolar) to be replaced by the amino acid glutamic acid (polar and negatively charged).
Chapter 4 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 4.1 - What is a genome and what is it composed of? What...Ch. 4.1 - Define the terms complementary and antiparallel as...Ch. 4.1 - Why is supercoiling essential to a bacterial cell?...Ch. 4.1 - Describe the central dogma of molecular biology....Ch. 4.2 - Approximately how large is the Escherichia coli...Ch. 4.2 - Prob. 2MQCh. 4.2 - Prob. 3MQCh. 4.2 - Prob. 1CRCh. 4.3 - Prob. 1MQCh. 4.3 - To which end (5 or 3) of a newly synthesized...
Ch. 4.3 - Prob. 3MQCh. 4.3 - What are the functions of DNA Pol I and III and...Ch. 4.3 - What is meant by the term semiconservative...Ch. 4.4 - Prob. 1MQCh. 4.4 - Prob. 2MQCh. 4.4 - Prob. 3MQCh. 4.4 - Prob. 1CRCh. 4.5 - What enzyme catalyzes transcription? What is a...Ch. 4.5 - Prob. 2MQCh. 4.5 - Prob. 3MQCh. 4.5 - Prob. 4MQCh. 4.5 - Prob. 1CRCh. 4.6 - What three major components make up an archaeal...Ch. 4.6 - Prob. 2MQCh. 4.6 - Prob. 3MQCh. 4.6 - How does the archaeal RNA polymerase differ from...Ch. 4.7 - Prob. 1MQCh. 4.7 - Differentiate between the different classes of...Ch. 4.7 - Prob. 3MQCh. 4.7 - Describe the two types of secondary structure a...Ch. 4.8 - Prob. 1MQCh. 4.8 - What is the function of the acceptor stem of a...Ch. 4.8 - Prob. 3MQCh. 4.8 - Prob. 1CRCh. 4.9 - Prob. 1MQCh. 4.9 - Prob. 2MQCh. 4.9 - Prob. 3MQCh. 4.9 - Why is the genetic code a degenerate code? What is...Ch. 4.10 - What are the components of a ribosome? What...Ch. 4.10 - How is a completed polypeptide chain released from...Ch. 4.10 - How does tmRNA free stalled ribosomes?Ch. 4.10 - Where on the ribosome do tRNAs bind, and what is...Ch. 4.11 - What are molecular chaperones and why are they...Ch. 4.11 - What macromolecules are protected by heat shock...Ch. 4.11 - How do chaperones assist the Escherichia coli cell...Ch. 4.11 - What proteins are involved in refolding misfolded...Ch. 4.12 - Prob. 1MQCh. 4.12 - Prob. 2MQCh. 4.12 - Prob. 3MQCh. 4.12 - Prob. 1CRCh. 4.13 - Prob. 1MQCh. 4.13 - Prob. 2MQCh. 4.13 - Prob. 3MQCh. 4.13 - Prob. 1CRCh. 4 - The genome of the bacterium Neisseria gonorrhoeae...Ch. 4 - Compare and contrast the activity of DNA and RNA...Ch. 4 - What would be the result (in terms of protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardYou are studying the rate of transcription of a particular eukaryotic gene. When the DNA located several thousand bases upstream from the gene is removed, the transcription rate of the gene decreases dramatically. How would you interpret these results?arrow_forwardThe sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forward
- The human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop site. The human rhodopsin protein is 348 amino acids. What is the length of the mature mRNA (starting at the start codon and ending at the stop codon) from which the rhodopsin protein is synthesized? Explain how you reached your answer, including information about introns, exons, and splicing.arrow_forwardHere is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardUsing the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines. You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely: 1.) Result in an alteration to the mRNA sequence. 2.)Have no effect on transcription or the mRNA sequence 3.)Prevent transcription at the TATAA box 4.) Result in an increase or decrease in the amount of mRNA transcribedarrow_forward
- Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to make an RNA molecule. It is performed by enzymes called RNA polymerases, which link nucleotides to form an RNA strand (using a DNA strand as a template). Transcription has three stages: initiation, elongation, and termination. What is the difference between Rho Dependent and Rho Independent termination in prokaryotes?arrow_forwardDuring the elongation phase of transcription, how is RNA polymerase able to "read" the DNA sequence of bases? O a. The RNA polymerase rotates like a corkscrew around the DNA helix - reading the sequence of bases while the two DNA strands remain completely hydrogen-bonded together. O b. The two DNA strands are temporarily reversed, so that the sugar-phosphate backbones are next to each other and the bases point outwards, allowing RNA polymerase to read the base sequence. O c. An enzyme complex unwinds and separates the two DNA strands down the full length of the gene (~1000-3000 bases), so that the RNA polymerase can travel smoothly along the template strand. O d. The RNA polymerase can separate the two strands of DNA as it travels, creating a small "window" between the strands, so it can read the template strand and create the complementary RNA copy.arrow_forwardDefine both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.arrow_forward
- After transcription has been completed in eukaryotes, the mRNA molecule first goes through some processing. Explain the 3 main things that are done during mRNA processing.arrow_forwardConsider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?arrow_forwarda) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY