Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4.12, Problem 3MQ
Summary Introduction
The synthesis of the protein from the mRNA sequence in the cytoplasm is known as translation. Proteins are composed of amino acids. A signal sequence or signal peptide is a short peptide chain (15 to 20 amino acid residues). The signal sequence is generally found in the newly synthesized N terminus of the protein sequence. The signal sequence signals to the translocase system and that helps to export the synthesized protein molecule across the cytoplasmic membrane.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What are the major differences between one-stepand two-step translocases? Which are used to secreteproteins into other cells?
What are the first 20 amino acids of the CFTR protein?
What events does the RecA protein facilitate?
Chapter 4 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 4.1 - What is a genome and what is it composed of? What...Ch. 4.1 - Define the terms complementary and antiparallel as...Ch. 4.1 - Why is supercoiling essential to a bacterial cell?...Ch. 4.1 - Describe the central dogma of molecular biology....Ch. 4.2 - Approximately how large is the Escherichia coli...Ch. 4.2 - Prob. 2MQCh. 4.2 - Prob. 3MQCh. 4.2 - Prob. 1CRCh. 4.3 - Prob. 1MQCh. 4.3 - To which end (5 or 3) of a newly synthesized...
Ch. 4.3 - Prob. 3MQCh. 4.3 - What are the functions of DNA Pol I and III and...Ch. 4.3 - What is meant by the term semiconservative...Ch. 4.4 - Prob. 1MQCh. 4.4 - Prob. 2MQCh. 4.4 - Prob. 3MQCh. 4.4 - Prob. 1CRCh. 4.5 - What enzyme catalyzes transcription? What is a...Ch. 4.5 - Prob. 2MQCh. 4.5 - Prob. 3MQCh. 4.5 - Prob. 4MQCh. 4.5 - Prob. 1CRCh. 4.6 - What three major components make up an archaeal...Ch. 4.6 - Prob. 2MQCh. 4.6 - Prob. 3MQCh. 4.6 - How does the archaeal RNA polymerase differ from...Ch. 4.7 - Prob. 1MQCh. 4.7 - Differentiate between the different classes of...Ch. 4.7 - Prob. 3MQCh. 4.7 - Describe the two types of secondary structure a...Ch. 4.8 - Prob. 1MQCh. 4.8 - What is the function of the acceptor stem of a...Ch. 4.8 - Prob. 3MQCh. 4.8 - Prob. 1CRCh. 4.9 - Prob. 1MQCh. 4.9 - Prob. 2MQCh. 4.9 - Prob. 3MQCh. 4.9 - Why is the genetic code a degenerate code? What is...Ch. 4.10 - What are the components of a ribosome? What...Ch. 4.10 - How is a completed polypeptide chain released from...Ch. 4.10 - How does tmRNA free stalled ribosomes?Ch. 4.10 - Where on the ribosome do tRNAs bind, and what is...Ch. 4.11 - What are molecular chaperones and why are they...Ch. 4.11 - What macromolecules are protected by heat shock...Ch. 4.11 - How do chaperones assist the Escherichia coli cell...Ch. 4.11 - What proteins are involved in refolding misfolded...Ch. 4.12 - Prob. 1MQCh. 4.12 - Prob. 2MQCh. 4.12 - Prob. 3MQCh. 4.12 - Prob. 1CRCh. 4.13 - Prob. 1MQCh. 4.13 - Prob. 2MQCh. 4.13 - Prob. 3MQCh. 4.13 - Prob. 1CRCh. 4 - The genome of the bacterium Neisseria gonorrhoeae...Ch. 4 - Compare and contrast the activity of DNA and RNA...Ch. 4 - What would be the result (in terms of protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'arrow_forwardWhat is mechanism of intein splicing to join P1 and P2 ? Which steps are reversible and which ones aren’t ?arrow_forwardWhat is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?arrow_forward
- What are prophase1?arrow_forwardWhere is transmembranelocated?arrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forward
- How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?arrow_forwardA section of the mRNA has a nucleotide sequence of CUAAUGGUU. Which of the following would be the t RNA binding sequence that would be the anti-codons for this mRNA? A) GTA, AUG, GUT, b) GUA, UAC, AUU, c) GTU, GGC, CAA, d) GAU, UAC, CAA, e) GAU, UAC, CCA.arrow_forward(b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Anaerobic Respiration; Author: Bozeman Science;https://www.youtube.com/watch?v=cDC29iBxb3w;License: Standard YouTube License, CC-BY