Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3.5, Problem 1C
VISUALIZE Sketch a pyrimidine
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles
A. Suppose that one of the precursors for the tetranucleotide in the diagram was a 32P-labeled
guanine nucleoside triphosphate (the innermost phosphate containing the radioactive
phosphorus). Where is the radioactive phosphorus atom (i.e., one of the solid black balls) as
it exists in the tetranucleotide
B. If spleen diesterase (which induces breaks between the phosphate and the 5’ carbon) is
used to digest the pictured tetranucleotide, state which base(s) among the breakdown
products will be expected to be attached to the 32P.
Compare and contrast the structure of DNA and RNA. Be sure to
describe each of the three components of a nucleotide for both DNA and RNA along with the types of bonds formed between the components. In addition, explain: how the nucleotides link together to form each molecule, why the prime ends are labeled 5’ and 3’, what antiparallel is, what phospodiester linkages are and what complementary base pairing is.
Chapter 3 Solutions
Biology (MindTap Course List)
Ch. 3.1 - Describe the properties of carbon that make it the...Ch. 3.1 - Define the term isomer and distinguish among the...Ch. 3.1 - Identify the major functional groups present in...Ch. 3.1 - Explain the relationship between polymers and...Ch. 3.1 - What are some of the ways that the features of...Ch. 3.1 - Prob. 2CCh. 3.1 - Prob. 3CCh. 3.1 - Prob. 4CCh. 3.1 - Prob. 5CCh. 3.2 - Distinguish among monosaccharides, disaccharides,...
Ch. 3.2 - VISUALIZE Draw simple sketches comparing the...Ch. 3.3 - Distinguish among fats, phospholipids, and...Ch. 3.3 - Prob. 1CCh. 3.3 - Explain why the structure of phospholipids enables...Ch. 3.4 - Give an overall description of the structure and...Ch. 3.4 - Prob. 8LOCh. 3.4 - Distinguish among the four levels of organization...Ch. 3.4 - Prob. 1CCh. 3.4 - Prob. 2CCh. 3.5 - Describe the components of a nucleotide. Name some...Ch. 3.5 - VISUALIZE Sketch a pyrimidine nucleotide subunit...Ch. 3.6 - Compare the functions and chemical compositions of...Ch. 3.6 - How can you distinguish a pentose sugar from a...Ch. 3 - Prob. 1TYUCh. 3 - VISUALIZE The structures depicted are (a)...Ch. 3 - Prob. 3TYUCh. 3 - The synthetic process by which monomers are...Ch. 3 - A monosaccharide designated as an aldehyde sugar...Ch. 3 - Structural polysaccharides typically (a) have...Ch. 3 - Saturated fatty acids are so named because they...Ch. 3 - Fatty acids in phospholipids and triacylglycerols...Ch. 3 - Which of the following levels of protein structure...Ch. 3 - Which of the following associations between R...Ch. 3 - Each phosphodiester linkage in DNA or RNA includes...Ch. 3 - PREDICT Do any of the amino acid side groups shown...Ch. 3 - PREDICT Like oxygen, sulfur forms two covalent...Ch. 3 - Hydrogen bonds and van der Waals interactions are...Ch. 3 - EVOLUTION LINK In what ways are all species alike...Ch. 3 - EVOLUTION LINK The total number of possible amino...Ch. 3 - EVOLUTION LINK Each amino acid could potentially...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the image attached, there are 4 nitrogenous bases plus ribose used to generate strands of DNA. They are oriented with hydrogen bonding regions aligned. Diagram the enol form of cytosine following a tautomeric shift. Include in the diagram how this change shifts hydrogen bonding characteristics and a new binding partner for this nucleotide.arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardDraw the DNA and RNA models in Figure 1 in the space provided. Use the legend below to represent the colored plastic chips with letters. Use lines to connect the letter representations of the plastic chips according to how they are attached to each other in Figure 1. These lines represent thechemical bonds between the different nucleic acid subunits. In the case of hydrogen bonds, specify the number of bonds such that one horizontal line corresponds to one hydrogen bond. Label the 5’ and 3’ ends of your polynucleotide strands. Br brown O orange B blue P pinkW white G green Y yellow R red Structure of Genetic Material DNA RNAarrow_forward
- Figure 3 represents one process that occurs during protein synthesis. amino acid molecule Q A UGC C GỤ AC C GAC Ų (a) Name the process shown. (b) Identify the molecule labelled Q. (c) In Figure 3, the first codon is AUG. Give the base sequence of the complementary DNA base sequence and the missing anticodon. Table 1 shows the base triplets that code for two amino acids. Table 1 Amino acid Encoding base triplet Aspartic acid GAC, GAU Proline CCA, CCG, CCC, CCU Aspartic acid and proline are both amino acids. (d) Describe how two amino acids differ from one another. You may use a diagram to help your description. (e) Deletion of the sixth base (G) in the sequence shown in Figure 3 would change the nature of the protein produced but substitution of the same base would not. Use the information in Table 1 and your own knowledge to explain why.arrow_forwardb. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run the same way? d. How are the chains connected? e. Which bases bond to each other? f. What kinds of bonds hold the chain together? 3. What are the main differences between RNA and DNA? 4. Distinguish between the structure of pyrimidines and purines. Explain why adenine bonds only to thymine. 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each base. Then indicate if the base if found in DNA (D), RNA (R), or both (B) hparrow_forwardConsider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary)as defined for proteins.(a) What level is shown by double-stranded DNA?(b) What level is shown by tRNA?(c) What level is shown by mRNA?arrow_forward
- Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stackingarrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).arrow_forwardChemistry Draw and label the following RNA tetranucleotide: 5'phosphoryl-A-2'O-methyl-C-U-G-3'- phosphate.arrow_forward
- Select TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups present in each nucleotide precursor remains present in a DNA polymer. 2. Starch and cellulose are alike in that both contain sugars bonded together in identical ways. 3. The coding strand of DNA is complementary in sequence to the corresponding MRNA. 4. Ribosomal RNA (rRNA) is synthesised by ribosomes in the process of translation. 5. Polyribosomes speed up the rate of transcription.arrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)arrow_forwardTo create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license