Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23.2, Problem 3R
Summary Introduction
To review:
(a) The positions, which encode amino acids, which may have changed due to positive selection.
(b) The positions, which encode amino acids, which may have changed due to purifying selection.
Given:
The following data was obtained by comparing the gene sequences of many genes encoding surface proteins in influenza viruses (Table 1):
Table 1: Synonymous and nonsynonymous substitutions at particular codon positions.
Codon position | Synonymous substitutions | Nonsynonymous substitutions |
12 | 0 | 7 |
15 | 1 | 9 |
61 | 0 | 12 |
80 | 7 | 0 |
137 | 12 | 1 |
156 | 24 | 2 |
165 | 3 | 4 |
226 | 38 | 3 |
Introduction:
A single-base substitution that does not lead to a change in the amino acid encoded by the gene is known as a synonymous substitution. A single-base substitution that changes the amino acid at a particular position is called a nonsynonymous mutation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence).
Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’
Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’
Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’
Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’
Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’
Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version.
1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain
Examine the following sashimi plot from a transcriptomics
experiment. The red peaks mostly
RNA STAR on data 22; data 16; ar
34 2
1
545326
550237
555148
560059
O a. correspond to exons and represent respective coverage of exons
O b. correspond to introns and represent respective coverage of introns
Chapter 23 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardYou obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base differences at three positions, all in different codons. One is a silent change, but the other two are missense changes (they encode new amino acids). How would you demonstrate that these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)arrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forward
- In a clinical context, a scientist is working with a viral DNA which is about 24000bps long. There are two known variants of the virus that share almost the same DNA but for a final fragment; with reference to Figure Q2b, the regions A and B are conserved in both variants, while the region C differs and is either 320bps (variant 1) or 380bps (variant 2). The scientist wants to set up a procedure to identify the variant they are dealing with. Viral dsDNA (i) (ii) (iii) Stable region (A) Variable region (C) Figure Q2b Known sequence (B) 5-GACCTCAATGTCCAGCGGTACGCTCATAAA-3' 3'-CTGGAGTTACAGGTCGCCATGCGAGTATTT-5' The scientists want to design a primer to amplify the variable region and to do so, they sequence a small fragment (sequence B) the conserved region close to the variable region C. Why is the scientist targeting a region outside of the fragment of interest? [3] The sequence of the fragment B is reported in Figure Q2b. Suggest a primer that can efficiently target this region and…arrow_forwardRepresentations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Valarrow_forwardMatch the following (most appropriate combinations): Gel filteration chromatography Electrophoresis Transition mutation Transversion mutation Missense mutation Frameshift mutation Southern blot Northern blot Western blot Separation of molecules in el [Choose ] Detection of protein Detection of RNA Causes triplet codons to be out of phase Detection of DNA Separation of molecules in electric current ✓ G changed to T C changed to T Separation of proteins in a column based on size Changes one amino acid codon into another Changes one amino acid co Detection of DNA Detection of RNA Detection of proteinarrow_forward
- You have sequenced the genome of the bacteriumSalmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimuriumgenome to known proteins. You find a protein thatis 100 percent identical in the bacterium Escherichiacoli. When you compare nucleotide sequences of theS. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the meritsof nucleotide- versus protein-similarity searches inidentifying related genes?arrow_forwardTranscribe and translate the mutated sequence #3. Determine the consequence, if any, for each mutation. You will need to use your codon charts in your ISN. Practice with both charts.arrow_forward4.08 H H 1.02 2.54 11.021 E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H = Hindill site H 0.81 EE 1.76 1.10 Fragment sizes are not to scale and all fragment lengths are in kilobase pairs (kbp) Draw the appearance of the autoradiogram of the Southern blot after hybridization with a cDNA probe. Iarrow_forward
- Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwardDesign primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'arrow_forwardConsider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp. A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY