The expected per-site mutation rate on the basis of the previous answer, assuming that the synonymous substitutions are neutral. Given: A hypothetical gene is taken. The sequencing of one of the exons of this gene has been done in four species. A matrix is provided below that represents the number of nonsynonymous (below the diagonal) and synonymous (above the diagonal) substitutions between different pairs of species (Figure 1). There are 600 synonymous and 2,000 nonsynonymous sites in the exon of this gene. Figure 1: A matrix of synonymous and nonsynonymous substitutions between different pairs of species. Introduction: Biologists are able make inferences about the natural selections, operating in the environment, by the study of molecular evolution patterns of genes. These inferences are important to know about the gene functions and their evolution over the time, in response to the new function and conditions. According to the given Figure 1, one exon of this gene is sequenced in four species. The data of synonymous and nonsynonymous substitutions and the phylogeny of the species of the Drosophila specie are given. There are 2,000 nonsynonymous and 600 synonymous substitutions sites of the exon.

Question

Want to see the full answer?

Answer 1

Question

Chapter 23, Problem 2Q

Summary Introduction

To review:

The expected per-site mutation rate on the basis of the previous answer, assuming that the synonymous substitutions are neutral.

Given:

A hypothetical gene is taken. The sequencing of one of the exons of this gene has been done in four species. A matrix is provided below that represents the number of nonsynonymous (below the diagonal) and synonymous (above the diagonal) substitutions between different pairs of species (Figure 1). There are 600 synonymous and 2,000 nonsynonymous sites in the exon of this gene.

Figure 1: A matrix of synonymous and nonsynonymous substitutions between different pairs of species.

Introduction:

Biologists are able make inferences about the natural selections, operating in the environment, by the study of molecular evolution patterns of genes. These inferences are important to know about the gene functions and their evolution over the time, in response to the new function and conditions. According to the given Figure 1, one exon of this gene is sequenced in four species. The data of synonymous and nonsynonymous substitutions and the phylogeny of the species of the Drosophila specie are given. There are 2,000 nonsynonymous and 600 synonymous substitutions sites of the exon.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing

Based on the information in Figure, which single-nucleotide mutationevent is more likely: Arg-to-His, or Arg-to-Ser? Explain.

Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this modifi ed cytosine pair? Does this generate atransition or a transversion mutation?