Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
8th Edition
ISBN: 9780134015187
Author: John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 22, Problem 22.83GP
Interpretation Introduction
Interpretation:
The major food sources of galactose in the diet has to be identified.
Concept Introduction:
Galactose is a simple sugar it founded in milk; it is one of the monosaccharide (like simple carbohydrate). It is rarely found in nature or in foods as it is commonly found linked with glucose, forming the disaccharide lactose.
Galactose pathway
- Galactose is a monosaccharide
- The lactose is sugar that is found in many foods, when the lactose is broken down in the body, glucose and galactose are produced.
- Galactose is converted into glucose in the body for energy purpose in the Leloir pathway.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
All of the following statements about glucose are true except:
Glucose is metabolized in the cytoplasm of prokaryotic organisms.
On a low-carb diet, keto acids from glucogenic amino acids will be used to synthesize glucose.
Glucose is metabolized in the mitochondria of mature red blood cells.
Under non-starvation conditions, the brain relies exclusively on glucose as its fuel source.
Lactose is found in milk products. It is converted by the body into a usable form in a series of chemical
reactions. The diagram shows the series of reactions that convert lactose into a usable form.
Enzyme 1
Enzyme 2
Enzyme 3
Enzyme 4
galactose-
1-phosphate
Lactose
galactose
glucose-
1-phosphate
glucose-
6-phosphate
If enzyme 2 is denatured (destroyed), the levels of which substance will increase?
One example of a stage 1 reaction in the heterotrophic breakdown of food molecules is:
the intramitochondrial digestion of pyruvate into carbon dioxide and water
the intramitochondrial digestion of fatty acids into carbon dioxide and water
the extracellular digestion of triglycerides into fatty acids and glycerol
the intracellular digestion of some amino acids into NH4+ and pyruvate
the intracellular digestion of glucose monomers into pyruvate
Chapter 22 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
Ch. 22.2 - Prob. 22.1PCh. 22.2 - Prob. 22.2PCh. 22.3 - Prob. 22.3PCh. 22.3 - Prob. 22.4PCh. 22.3 - Prob. 22.5PCh. 22.3 - Prob. 22.6KCPCh. 22.4 - Prob. 22.1CIAPCh. 22.4 - Prob. 22.2CIAPCh. 22.4 - Prob. 22.3CIAPCh. 22.4 - Explain the chemical process that leads to...
Ch. 22.4 - Prob. 22.5CIAPCh. 22.4 - Prob. 22.7PCh. 22.4 - Prob. 22.8PCh. 22.5 - In alcoholic fermentation, each mole of pyruvate...Ch. 22.5 - Name three ways humans have exploited the ability...Ch. 22.5 - Pyruvate has three different fates. What are the...Ch. 22.6 - Prob. 22.12PCh. 22.6 - Prob. 22.13PCh. 22.7 - Prob. 22.14PCh. 22.7 - Prob. 22.15PCh. 22.7 - Prob. 22.16KCPCh. 22.7 - Prob. 22.6CIAPCh. 22.7 - Prob. 22.7CIAPCh. 22.7 - Prob. 22.8CIAPCh. 22.8 - Prob. 22.17PCh. 22.8 - Prob. 22.18PCh. 22.9 - Prob. 22.19PCh. 22.9 - Prob. 22.20PCh. 22.9 - Prob. 22.21PCh. 22.9 - Prob. 22.9CIAPCh. 22.9 - Prob. 22.10CIAPCh. 22.9 - Prob. 22.11CIAPCh. 22.9 - Prob. 22.12CIAPCh. 22 - What class of enzymes catalyzes the majority of...Ch. 22 - Prob. 22.23UKCCh. 22 - Prob. 22.24UKCCh. 22 - Prob. 22.25UKCCh. 22 - Classify each enzyme of glycolysis into one of the...Ch. 22 - Prob. 22.27UKCCh. 22 - Name the molecules used for gluconeogenesis. What...Ch. 22 - Prob. 22.31APCh. 22 - Prob. 22.32APCh. 22 - Prob. 22.33APCh. 22 - Prob. 22.34APCh. 22 - Prob. 22.35APCh. 22 - Prob. 22.36APCh. 22 - Prob. 22.37APCh. 22 - Prob. 22.38APCh. 22 - Prob. 22.39APCh. 22 - Prob. 22.40APCh. 22 - Prob. 22.41APCh. 22 - Prob. 22.42APCh. 22 - Prob. 22.43APCh. 22 - Prob. 22.44APCh. 22 - Prob. 22.45APCh. 22 - Review the 10 steps in glycolysis (Figure 22.3)...Ch. 22 - Prob. 22.47APCh. 22 - Prob. 22.49APCh. 22 - Prob. 22.50APCh. 22 - Prob. 22.51APCh. 22 - How many moles of acetyl-CoA are produced by the...Ch. 22 - Prob. 22.53APCh. 22 - Prob. 22.54APCh. 22 - Prob. 22.55APCh. 22 - Prob. 22.56APCh. 22 - Prob. 22.57APCh. 22 - Prob. 22.58APCh. 22 - Prob. 22.59APCh. 22 - Why does glycogenolysis use fewer steps than the...Ch. 22 - Prob. 22.61APCh. 22 - Prob. 22.62APCh. 22 - Prob. 22.63APCh. 22 - Prob. 22.64APCh. 22 - Prob. 22.65APCh. 22 - Prob. 22.66APCh. 22 - Prob. 22.67APCh. 22 - Prob. 22.68APCh. 22 - Why can pyruvate cross the mitochondrial membrane...Ch. 22 - Look at the glycolysis pathway (Figure 22.3). With...Ch. 22 - Prob. 22.71CPCh. 22 - Prob. 22.72CPCh. 22 - Prob. 22.74CPCh. 22 - Prob. 22.75CPCh. 22 - Prob. 22.76CPCh. 22 - Why is it important for the cell that the NADH...Ch. 22 - Prob. 22.78CPCh. 22 - Prob. 22.79CPCh. 22 - Prob. 22.80CPCh. 22 - Prob. 22.81CPCh. 22 - Prob. 22.82GPCh. 22 - Prob. 22.83GPCh. 22 - It is important to avoid air when making wine, so...Ch. 22 - Prob. 22.85GP
Knowledge Booster
Similar questions
- One example of a stage 2 reaction in the heterotrophic breakdown of food molecules is: the extracellular digestion of amylopectin into glucose monomers the intramitochondrial digestion of fatty acids into carbon dioxide and water the intracellular digestion of glucose monomers into pyruvate the extracellular digestion of triglycerides into fatty acids and glycerol the extracellular digestion of polypeptides into amino acids  Identify the three-carbon glycolysis intermediate which can be formed, in the cytoplasm, in one enzymatic step (during deamination of the amino acid alanine)? pyruvate fructose-1,6-bisphosphate fructose glucose-6-phosphate glucosearrow_forwardThiamine is the vitamin precursor for a co-enzyme called thiamine pyrophosphate or TPP.  A patient diagnosed with thiamine deficiency exhibited fatigue and muscle cramps. The muscle cramps have been related to the accumulation of specific metabolic acids. On the following list, circle the metabolic acids that are most likely to accumulate in a thiamine deficiency?  Note: There may be more than one.   Isocitrate Pyruvate Succinate α-ketoglutarate Malate Fumarate  (b) Provide a brief explanation for your answer to 1 (a) herearrow_forwardWhy does the lack of glucose 6-phosphatase activity in the brain and muscle make good physiological sense? Glucose 6-phosphatase allows cells to trap glucose in the cell; however, these tissues primarily rely on noncarbohydrate energy sources. Glucose 6-phosphatase allows cells to generate glucose through gluconeogenesis; however, gluconeogenesis only takes place in the liver. Glucose 6-phosphatase allows cells to release glucose into the blood; however, these tissues should never release glucose. Glucose 6-phosphatase provides glucose 6-phosphate for glycogen synthesis; however, these tissues do not need glycogen.arrow_forward
- Fructose is a labeled on its anomeric carbon with 14C. This labeled fructose is added to muscle cells under anaerobic glycolytic conditions, and the secreted lactate is collected. Which carbon in the secreted lactate (shown below) contains the 14C label? دیده OH Carbon 2 Carbon 1 Carbon 3 No carbon contains the label.arrow_forwardWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardOne example of a stage 3 reaction in the heterotrophic breakdown of food molecules is: the intramitochondrial digestion of fatty acids into carbon dioxide and water the intracellular digestion of glucose monomers into pyruvate the intracellular digestion of some amino acids into NH4+ and pyruvate the extracellular digestion of polypeptides into amino acids the extracellular digestion of triglycerides into fatty acids and glycerolarrow_forward
- One condition is ketoacidosis (low blood pH) which is a potentially life-threatening state, most commonly experienced by diabetics. Ketoacidosis, however, is not typically an issue for healthy people who are following a ketogenic diet. What is the difference between ketoacidosis and ketosis? Why do diabetics sometimes develop ketoacidosis, while healthy people rarely do? Healthy people are well equipped to survive on a ketogenic diet. Why is it important that humans evolved to have the ability to survive without carbohydrate nutrients?arrow_forwardA glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are cleaved completely by an enzyme. How many individual glucose molecules are created during this process?arrow_forwardOne of the most common enzyme deficiencies in humans is a mutation in the gene coding for glucose 6-phosphate dehydrogenase, which catalyzes the first step in the pentose phosphate pathway. If you suspected a patient in your clinic to have this enzyme deficiency and you ordered a blood analysis, which of the following pairs of metabolites would you find to be at reduced levels? O ribose/NADPH O lactate/NADH O fructose 1,6-bisphosphate/NAD O glucose/NADPH O deoxyribose/NADParrow_forward
- Maltase is an enzyme that catalyzes the hydrolysis of the disaccharide maltose. This process occurs during human digestion when maltase is secreted by the intestine and then converts maltose into glucose. Which two classes of biomolecules are directly involved in this process?arrow_forwarda) Describe the structure of a glycogen molecule. (you can explain without drawing) b) List the three enzymes involved in glycogen degradation and describe the type of reactions they catalyze c) Fill in the numbered blanks in the figure which is the list the source and fates of glucose-6- phosphate. Glycogen pentose phosphate pathway Glucose-6-phosphate Ribose-G-phosphate Glucose glycolysis 3 Amino acida |Lactate Citric acid cyclearrow_forwardThe break down of sugar occurs in biological cells. It goes through multiple stages to produce energy that cells use. One series of reactions during this process is call the citrus acid cycle. Discuss how you could either speed up or slow down the degradation of glucose through the citrus acid cycle? (Hint: look at the citrus acid cycle and choose one step)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON