Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 6PDQ
Annotation involves identifying genes and gene-regulatory sequences in a genome. List and describe characteristics of a genome that are hallmarks for identifying genes in an unknown sequence. What characteristics would you look for in a bacterial genome? A eukaryotic genome?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Annotation involves identifying genes and gene-regulatory sequences in a genome. List and describe characteristics of a genome that are hallmarks for identifying genes in an unknown sequence. What characteristics would you look for in a bacterial genome? A eukaryotic genome?
Place the steps necessary to perform RNA-Seq in the correct order.
Drag the text blocks below into their
correct order.
Reset
MAAAAAAAAAKK
MAAAAAAAAAAM
Compare sequences to known genome sequence.
Create cDNA using reverse transcription with primers
complementary to linkers.
Attach linkers to the ends of the RNAs.
Perform next-generation DNA sequencing.
Isolate RNA from cells or tissues of interest.
Fragment the RNAs.
Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp.
A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?
Chapter 21 Solutions
Concepts of Genetics (12th Edition)
Ch. 21 - In a sequence encompassing 99.4 percent of the...Ch. 21 - Annotation of a proteome attempts to relate each...Ch. 21 - Because of its accessibility and biological...Ch. 21 - If you had Crohns disease or ulcerative colitis...Ch. 21 - Prob. 2CSCh. 21 - Prob. 3CSCh. 21 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 21 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 21 - What is functional genomics? How does it differ...Ch. 21 - Compare and contrast WGS to a map-based cloning...
Ch. 21 - What is bioinformatics, and why is this discipline...Ch. 21 - Annotation involves identifying genes and...Ch. 21 - Prob. 7PDQCh. 21 - BLAST searches and related applications are...Ch. 21 - What functional information about a genome can be...Ch. 21 - Describe three major goals of the Human Genome...Ch. 21 - Describe the human genome in terms of genome size,...Ch. 21 - The Human Genome Project has demonstrated that in...Ch. 21 - Through the Human Genome Project (HGP), a...Ch. 21 - Explain differences between whole-genome...Ch. 21 - Describe the significance of the Genome 10K...Ch. 21 - Prob. 16PDQCh. 21 - Prob. 17PDQCh. 21 - What are DNA microarrays? How are they used?Ch. 21 - Prob. 19PDQCh. 21 - Prob. 20PDQCh. 21 - Researchers have compared candidate loci in humans...Ch. 21 - Homology can be defined as the presence of common...Ch. 21 - Prob. 23ESPCh. 21 - Prob. 24ESPCh. 21 - Whole-exome sequencing (WES) is helping physicians...Ch. 21 - Recall that when the HGP was completed, more than...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Jackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat shock gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Jackson finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardAssume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?arrow_forwardIf you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?arrow_forward
- You have assembled a new prokaryotic genome and are annotating the genes. If you were to search for highly conserved sequences necessary for normal gene expression, what type of annotation are you doing? Group of answer choices ad hoc annotation homology based annotation preliminary annotation ab initio annotationarrow_forwardIhsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Ihsan finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardWhat is a database? What types of information are stored within adatabase? Where does the information come from? Discuss theobjectives of a genome database.arrow_forward
- In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forwardEach of the following describes a distinctive step in a genomic technology or experimental design. Match the name of the technology or experimental design to the description. Answers may be used more than once or not at all. Add fluorescent tags onto the single-stranded sample of nucleic acids before the sample is applied to a glass slide. [ Choose ]When aligned to a reference genome, read depth indicates duplications and deletions. [ Choose ]A spot appears as a mix of two fluorescent colors if the individual is heterozygous. [ Choose ]An experimental design that relies on identifying unrelated individuals that have one of two phenotypes, then looking for a correlation between individual phenotype and genotype. [ Choose ] choices: GWAS, RNA microarray, RNA sequencing, DNA microarray, quantitative genetics, family study, genomic resequencingarrow_forwardWhy are closure and completeness important in genome sequencing?arrow_forward
- Identify the MRNA sequence that encodes the protein Design primers that will allow them to amplify the gene sequence using PCR.arrow_forwardDescribe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is added or (b) too much ddNTP is added.arrow_forwardIn automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space The polypeptide sequence is:arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license