If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?

If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?

Case Studies In Health Information Management

3rd Edition

ISBN:9781337676908

Author:SCHNERING

Publisher:SCHNERING

Chapter4: Revenue Management

Section: Chapter Questions

Problem 4.16.2C

See similar textbooks

Similar questions

Align two sequences: horizontal – GGAATGG, vertical – ATG, m=1, mm = 0, g=-1. Use the table below for the NW matrix. Write down and score all optimal global alignments. Complete the NW matrix below and show the alignment paths. Use the arrows and circles for the matrix and paths. Click the shapes and move them using your keyboard arrow keys (or drag). Click the shapes and then right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in Windows MS Word). 0000 Align and score 4 optimal alignments here. the first line, v sequence in the second line and Each alignment should have h sequence individual scores for each alignment position in the third line.
Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences. asap
Consider the following distance matrix: A B C D A B C D ☆ 0.1 0.4 0.3 0.8 0.6 0.2 Using the UPGMA algorithm, answer the following questions: a) What two sequences are the most related? Which are the least related? b) Does the following tree accurately capture the relationship among the sequ in the distance matrix (ignoring branch lengths)? Explain in detail why or why
What is the E-value of the sequence, what does your E-value reflect and what’s the importance of an E-value?
You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.
Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
Align two sequences: horizontal – GGAATGG, vertical – ATG, m= 2, mm = 0, g/o = -2, g/e = -1. Complete the NW matrix below and show the alignment paths. Write down and score all optimal alignments. Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Click the shapes and move them using arrow keys (or drag). Click the shapes and right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in MS Word). 0000 Align and score all optimal alignments here. 0000
Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?
Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... | | | | | ATAGGAGCGAGAGT
what is a palindromic sequence?
Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtga
what is the minimum edit distance between the following pair of sequences? TTGACG TTTAGT - 0 - 1 - 2 - 3