Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21, Problem 19PDQ
Summary Introduction
To determine: The term discrepancy and the process by which it can be reconciled.
Introduction: The annotation of the human genome sequence tend to reveal the discrepancy between several predicted proteins expressed in the genome and the number of the protein-coding sequences. The proteomic analysis indicated that human cells are capable of synthesizing more than 100000 different proteins and perhaps triple of this number.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables, determine the complementary mRNA sequence for the five portions of the Mc1r gene provided. (Note: You are only transcribing short portions of the DNA sequence for this protein. The actual gene contains 954 base pairs.)
Using the mRNA sequence completed, determine the resulting amino acid sequence of the MC1R protein. (Note: You are translating only a portion of protein. The full protein is 317 amino acids long. The numbers above the columns in the tables indicate amino acid positions in the protein sequence.) You may use the genetic code chart provided
The abundance of three mRNA transcripts, transcripts A, B, and C, was measured by real-time PCR. The average CT values were 14.6, 20.2, and 10.5 for transcripts A, B, and C, respectively. Determine the relative order of abundance of the transcripts. Name one technique that could be used to confirm that the order of abundance at the mRNA transcript level is reflected at the protein level.
In relation to central dogma of molecular biology answer the following questions:
The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?
Chapter 21 Solutions
Concepts of Genetics (12th Edition)
Ch. 21 - In a sequence encompassing 99.4 percent of the...Ch. 21 - Annotation of a proteome attempts to relate each...Ch. 21 - Because of its accessibility and biological...Ch. 21 - If you had Crohns disease or ulcerative colitis...Ch. 21 - Prob. 2CSCh. 21 - Prob. 3CSCh. 21 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 21 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 21 - What is functional genomics? How does it differ...Ch. 21 - Compare and contrast WGS to a map-based cloning...
Ch. 21 - What is bioinformatics, and why is this discipline...Ch. 21 - Annotation involves identifying genes and...Ch. 21 - Prob. 7PDQCh. 21 - BLAST searches and related applications are...Ch. 21 - What functional information about a genome can be...Ch. 21 - Describe three major goals of the Human Genome...Ch. 21 - Describe the human genome in terms of genome size,...Ch. 21 - The Human Genome Project has demonstrated that in...Ch. 21 - Through the Human Genome Project (HGP), a...Ch. 21 - Explain differences between whole-genome...Ch. 21 - Describe the significance of the Genome 10K...Ch. 21 - Prob. 16PDQCh. 21 - Prob. 17PDQCh. 21 - What are DNA microarrays? How are they used?Ch. 21 - Prob. 19PDQCh. 21 - Prob. 20PDQCh. 21 - Researchers have compared candidate loci in humans...Ch. 21 - Homology can be defined as the presence of common...Ch. 21 - Prob. 23ESPCh. 21 - Prob. 24ESPCh. 21 - Whole-exome sequencing (WES) is helping physicians...Ch. 21 - Recall that when the HGP was completed, more than...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.arrow_forwardthis is what i have said about this image so far, what else can be said aswell including the raw count column. " Interpreting the results of an RNA-Seq analysis is pivotal in understanding the underlying genetic mechanisms of diseases such as breast cancer. In this analysis, Figure 1 provides comprehensive data on differentially expressed genes associated with breast cancer. By delving into the provided information, we can gain valuable insights into the molecular landscape of this disease. First focus is on the gene with the highest fold change, EYA4, situated on chromosome 6. With a staggering fold change of 3604.4176, EYA4 exhibits an unprecedented level of overexpression in cancerous cells compared to normal cells. This profound alteration suggests a pivotal role for EYA4 in breast cancer pathogenesis. The log2 fold change of 11.81555 further emphasizes the magnitude of this difference in gene expression. Statistical significance is evident, with an exceptionally low p-value of…arrow_forwardYou have created three different mutations in the histoneH1 protein (HISmut1, HISmut2, HISmut3), and each of these mutations eliminate a stretch of 5 amino acids from the primary sequence. Based on the description of where you find the mutant histoneH1 proteins when you look inside a cell in each of the cases below, describe 1) what the function is of the amino acids that were removed, and 2) what is not happening with the mutant histoneH1 protein that does happen with wild type H1: 1. HISmut2 protein is found in the cytoplasm, and never in the nucleus. 2. HISmut1 protein is found in only briefly in the cytoplasm because it is very quickly sent to the proteasome. 3. HISmut3 protein is found floating freely throughout the nucleoplasm.arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardThe genomes of most multicellular eukaryotes encode~25,000 genes, yet their proteomes contain over 200,000proteins. Propose two processes that, taken together, account for this discrepancyarrow_forwardYou are interested in finding out the function of a particular gene in the mouse genome. You have determined the nucleotide sequence of the gene, defined the portion that codes for its protein product, and searched the relevant database for similar sequences; however, neither the gene nor the encoded protein resembles anything previously described. What types of additional information about the gene and the encoded protein would you like to know in order to narrow down its function, and why?arrow_forward
- Histones are proteins that are found to be challenging to investigate and part of an enormous family of genes. In addition to Histones, another challenging gene is Ubiquitin (Ub). Find the number of ubiquitins in the human genome and what is the sequence of a representative/ prototypical ubiquitin?arrow_forwardThe entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URFs). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows:15 percent are lethal when knocked out.25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth).60 percent show no detectable mutant phenotype at all and resemble wild type.Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.arrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forward
- The entire genome of the yeast Saccharomyces cerevisiaehas been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-sizesequences with appropriate translational initiation andtermination signals) in the genome. Some of these ORFsare previously known genes with established functions;however, the remainder are unassigned reading frames(URFs). To deduce the possible functions of the URFs,they are being systematically, one at a time, convertedinto null alleles by in vitro knockout techniques. The results are as follows:15 percent are lethal when knocked out.25 percent show some mutant phenotype (alteredmorphology, altered nutrition, and so forth).60 percent show no detectable mutant phenotype at alland resemble wild type.Explain the possible molecular-genetic basis of thesethree mutant categories, inventing examples wherepossible.arrow_forwardIf mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and visualized by electron microscopy, two types of structures are seen: RNA:DNA double-stranded heteroduplexes and single stranded DNA loop structures, as shown in the diagrams below. What do you think these single stranded DNA loops represent? (a) Micrograph of DNA-RNA hybrid (b) Interpretation of micrograph Single-stranded DNA only Single-stranded DNA base paired with MRNA Select one: а. Exons b. Introns c. 5' UTR d. 3' UTR e. promoterarrow_forwarda. How can a single eukaryotic gene give rise to several different types of mRNA molecules?b. Excluding the possible rare polycistronic message,how can a single mRNA molecule in a eukaryoticcell produce proteins with different activities?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License