Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 20.L2, Problem 11CT
"There is no circumstance [in which] you can cook out 230 million bacteria. I’m not willing to take the risk that one pathogen isn’t going to survive"—Ron Schnitzer (microbiologist). Comment on this quote. What do you think this microbiologist is referring to?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Pick a specific microbiome (i.e. skin, mouth, gut, reproductive) and discuss interesting points and how it is important to human health/diversity/etc.
Here you can discuss any aspect of the microbiome that you like. Whatever is of most interest to you personally for example the uniqueness of an individual’s microbiome or disease states due to disruptions in bacterial communities, etc.
Find a recent (2015 or newer) primary research article that investigates some aspect of the microbiome environment that you discussed in question 2 and discuss the findings and how it has increased our understanding of the microbiome.
in your own words, what is the accuracy of claims about chron's disease being impacted by our gut microbiota
Your microbiome is composed of?
Question options:
The transient microbiota and genetic material of a person
The resident microbiota and genetic material of a person
The transient microbiota of a person
The transient and resident microbiota of a person
Chapter 20 Solutions
Foundations in Microbiology
Ch. 20.1 - Explain the effect of the virulence factor common...Ch. 20.1 - Identify those people most at risk of developing a...Ch. 20.1 - Briefly describe the human infections caused by...Ch. 20.1 - How can antibiotic treatment of a gram-negative...Ch. 20.2 - Name the genera of bacteria that are...Ch. 20.2 - Outline the pathology and epidemiology of...Ch. 20.2 - Explain the epidemiology of Francisella tularensis...Ch. 20.2 - Prob. 6ELOCh. 20.2 - Prob. 7ELOCh. 20.2 - Prob. 8ELO
Ch. 20.2 - List the four genera of bacteria that cause...Ch. 20.2 - Prob. 4CYPCh. 20.2 - Prob. 5CYPCh. 20.2 - Prob. 6CYPCh. 20.2 - What is unusual about the reservoir of Legionella?...Ch. 20.3 - Recall the medically important members of the...Ch. 20.3 - Prob. 10ELOCh. 20.3 - Explain the importance of the three major surface...Ch. 20.3 - Name the key characteristics shared by the...Ch. 20.3 - Explain what is meant by IMViC.Ch. 20.3 - Prob. 10CYPCh. 20.3 - Prob. 11CYPCh. 20.3 - Briefly describe the methods used to isolate and...Ch. 20.3 - Prob. 13CYPCh. 20.4 - Differentiate among the major enteric pathologies...Ch. 20.4 - Explain the role of E. coli in infantile and...Ch. 20.4 - Prob. 14ELOCh. 20.4 - Prob. 15ELOCh. 20.4 - Prob. 14CYPCh. 20.4 - Prob. 15CYPCh. 20.4 - Justify treating E. coli Ol57:H7 differently from...Ch. 20.4 - Prob. 17CYPCh. 20.4 - Prob. 18CYPCh. 20.5 - Differentiate between true noncoliform enteric...Ch. 20.5 - Distinguish the pathologies of typhoidal and...Ch. 20.5 - Identify the possible sources of Shigella...Ch. 20.5 - Prob. 19ELOCh. 20.5 - Prob. 20ELOCh. 20.5 - Prob. 19CYPCh. 20.5 - Prob. 20CYPCh. 20.5 - Make a comparison chart for Shigella and...Ch. 20.5 - What are the Five F’s and how do they relate to...Ch. 20.5 - Prob. 23CYPCh. 20.5 - Which body systems are commonly infected by...Ch. 20.5 - Describe the epidemiology and pathology of...Ch. 20.L1 - A unique characteristic of many isolates of...Ch. 20.L1 - Prob. 2MCQCh. 20.L1 - Prob. 3MCQCh. 20.L1 - A classic symptom of pertussis is a. labored...Ch. 20.L1 - Prob. 5MCQCh. 20.L1 - Prob. 6MCQCh. 20.L1 - Prob. 7MCQCh. 20.L1 - Which of the following is a major difference...Ch. 20.L1 - A complication/complications of typhoid fever...Ch. 20.L1 - Prob. 10MCQCh. 20.L1 - Prob. 11MCQCh. 20.L1 - Haemophilus influnzae is ____________ and requires...Ch. 20.L1 - Prob. 13MCQCh. 20.L1 - Prob. 14MCQCh. 20.L1 - Single Matching. Match the infectious agent with...Ch. 20.L1 - Prob. 1CSRCh. 20.L1 - Prob. 2CSRCh. 20.L1 - Prob. 3CSRCh. 20.L1 - Prob. 1WCCh. 20.L1 - What are unique features in the epidemiology of E....Ch. 20.L1 - Explain several practices an individual can use to...Ch. 20.L1 - Prob. 4WCCh. 20.L1 - Briefly outline the zoonotic infections in this...Ch. 20.L2 - What is the logic behind testing for E. coli to...Ch. 20.L2 - Identify the genera with the following...Ch. 20.L2 - Given that so many infections arc caused by...Ch. 20.L2 - Prob. 4CTCh. 20.L2 - Students in our classes sometimes ask how it is...Ch. 20.L2 - Explain lhe reasons for an increase in numbers of...Ch. 20.L2 - Compare and contrast the pathology, diagnosis, and...Ch. 20.L2 - Prob. 8CTCh. 20.L2 - Prob. 9CTCh. 20.L2 - Prob. 10CTCh. 20.L2 - "There is no circumstance [in which] you can cook...Ch. 20.L2 - Use figure 20.5 a, b as a reference guideline for...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Allyson Byrd mechanisms by which microbiome can inhibit infectious diseases .)arrow_forwardWhich of the following situations does NOT demonstrate the importance of a healthy microbiome? Group of answer choices Anthony suffers from debilitating diarrhea after a lengthy course of antibiotics to treat his MRSA infection. Andy is lactose intolerant. His body does not break down lactose, so the microorganisms in the gut do it for him. Mary suffers from colon cancer. While being treated, she develops an opportunistic Bacteroides fragilis infection. Jenna is prone to yeast infections, so she routinely eats yogurt and takes a probiotic supplement to increase the amount of lactic acid bacteria in her vagina.arrow_forwardI need help answering this question to my professor: The topic for the discussion was this one: Some potentially pathogenic bacteria and fungi, including strains of Enterococcus, Staphylococcus, Candida, and Aspergillus, can survive for one to three months on a variety of materials found in hospitals, including scrub suits, lab coats, plastic aprons, and computer keyboards. What can hospital personnel do to reduce the spread of these pathogens? My answer was this one: To reduce the spread of these pathogens an infection control protocol should be followed. Some ways in which this could be reduced is by using desinfectants, sterilization, hand washing, and disposing techniques. In addition, I currently work as a dental assistant at Jackson Main and the protocol we use is hand washing our hands for at least 20 seconds before and after seeing every patient. We use CaviWipes to disinfect every surface and autoclave every single instrument after every use. Also, we make sure to…arrow_forward
- Do you think that it is correct that the blood has no microbiota? YOU CAN MAKE A CASE EITHER WAY. This is a question where I just want you to think and make an argument for or against the statement in the book that the blood has no microbes.arrow_forwardThis is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsarrow_forward4. Figure 1 (see next page) depicts the timeline of Sammy's chlamydia infection. Each panel of the figure represents a blood sample, showing a stain of the chlamydia bacteria. The red dots indicate the initial chlamydia bacteria, and the yellow dots indicate the mutated chlamydia bacteria. Provide detailed captions for the images under the titles, specifically indicating how the bacteria population changed over time. "The Fight Against Bacteria" by Jessie M. Garcia Page 3 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Figure 1a. Initial chlamydia infection. Figure 1b. Three days into the doxycycline treatment. Figure 1c. Sammy stops taking her antibiotic pills. Figure 1d. One week after the doxycycline treatment. Figure 1e. Two weeks after the doxycycline treatment.arrow_forward
- Explaining the role of the microbiome in human health, wellness, and immunity. Include the origin of microbiota colonization. [Here, you will be expected to provide explicit details. Take a close look at the vignettes in the textbook on the microbiota]arrow_forwardAn example of a recent discovery about the impact of the microbiome on our health. (Cite the sources)arrow_forwardA student argues that it makes no sense to be concerned about coliforms in drinking water because they are harmless members of our normal microbiota. Explain why regulatory agencies are concerned about coliforms.arrow_forward
- Rabies lyssavirus Characterization of etiologic agent | Life cycle or infectious cycle | Diagnosis | Epidemiology | Symptoms Mechanism of Pathogenicity/immune response/immune evasion | Treatment | Current status | Opinion of the Future of this disease References Etiologic Agent: The microbial agent that causes the disease must be identified and correctly characterized. Further, the life or infectious cycle of this microbe/ organism should be described thoroughly. This discussion should include the means by which this disease is spread among humans. Diagnosis: How is the disease diagnosed? Briefly describe the test(s) involved and how they work. Symptoms: The symptoms of this disease should be described thoroughly. If there is a significant asymptomatic period, that should be described as well. Epidemiology: Who is most likely to contract this disease? How does the disease affect people of different races, genders, behaviors, ages, geographical locations? Is the disease hospital- or…arrow_forwardgo to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…arrow_forwardMicrobiota In healthy humans, the internal organs and tissues such as muscles, the brain, and blood do not contain microorganisms. However, surface tissues, such as the skin and mucous membranes, are in continuous contact with environmental microbes and become readily colonized by specific bacteria. The population of microbes regularly found in the body is referred to as the normal microbiota. The term transient microbiota refers to members of the normal microbiota that are present for only a short time before disappearing. A person's normal microbiota is an important part of the immune system, as the normal microbiota often inhibit pathogenic microbes from colonizing the host, a process called microbial antagonism. Different types of bacteria will colonize different niches in a person's body due to variations in moisture level, pH. atmospheric pressure, oxygen levels, and body secretions. Accordingly, different types of medila must be used to culture the various human microbiota. If…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage Learning
Microbiology for Surgical Technologists (MindTap ...
Biology
ISBN:9781111306663
Author:Margaret Rodriguez, Paul Price
Publisher:Cengage Learning
Biochemical Tests-Part 1; Author: Southern Stacker;https://www.youtube.com/watch?v=a-i9vANfQWQ;License: Standard Youtube License