Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 20, Problem 7CONQ
Summary Introduction
To review:
The production and occurrence of recombinant and non-recombinant chromosomes through resolution step of the Holliday model of homologous recombination.
Introduction:
The Holliday model was proposed by the Robin Holliday in 1964 for the formation of heteroduplex and the gene conversion at the time of recombination. This model has a key role in the homologous type of recombination.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Based on the attached image, if we are using the Holliday junction model of recombination, where exactly would be the positions where DNA is cut? Would it be to the right because of branch migration?
E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope 15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N. Using a solid line to represent a heavy polynucleotide chain and a dashed line for a light chain, sketch each of the following descriptions:a. The heavy parental chromosome and the products of the first replication after transfer to a 14N medium, assuming that the chromosome is one DNA double helix and that replication is semiconservative.b. Repeat part a, but now assume that replication is conservative.c. If the daughter chromosomes from the first division in 14N are spun in a cesium chloride density gradient and a single band is obtained, which of the possibilities in parts a and b can be ruled out? Reconsider the Meselson and Stahl experiment: What does it prove?
In each of the illustrations below, a segment of a chromosome has two copies of a transposable element. In panel a, they are oriented in the same direction, whereas in panel b they are in opposite directions.
A double strand break occurs in element A and is repaired by homologous recombination using element B as a repair template. For each case, what will the chromosome look like after homologous recombination occurs? Choose one of the five options below, 1-5.
Chapter 20 Solutions
Genetics: Analysis and Principles
Ch. 20.1 - 1. Homologous recombination refers to the exchange...Ch. 20.1 - During the molecular process of homologous...Ch. 20.1 - 3. A key difference between the original Holliday...Ch. 20.1 - Which of the following mechanisms can cause gene...Ch. 20.2 - 1. During site-specific recombination that occurs...Ch. 20.2 - Prob. 2COMQCh. 20.3 - Which of the following types of transposable...Ch. 20.3 - Prob. 2COMQCh. 20.3 - Prob. 3COMQCh. 20 - 1. Describe the similarities and differences...
Ch. 20 - Prob. 2CONQCh. 20 - 3. Which steps in the double-strand break model...Ch. 20 - Prob. 4CONQCh. 20 - Prob. 5CONQCh. 20 - Prob. 6CONQCh. 20 - Prob. 7CONQCh. 20 - 8. What is gene conversion?
Ch. 20 - Make a list of the differences between the...Ch. 20 - Prob. 10CONQCh. 20 - Prob. 11CONQCh. 20 - 12. According to the double-strand break model,...Ch. 20 - What type of DNA structure is recognized by RecG...Ch. 20 - Briefly describe three ways that antibody...Ch. 20 - 15. Describe the functions of the RAG1 and RAG2...Ch. 20 - According to the scenario shown in Figure 20.7,...Ch. 20 - Prob. 17CONQCh. 20 - Prob. 18CONQCh. 20 - 19. Why does transposition always produce direct...Ch. 20 - 20. Which types of TEs have the greatest potential...Ch. 20 - Prob. 21CONQCh. 20 - 22. Let’s suppose that a species of mosquito has...Ch. 20 - This chapter describes different types of TEs,...Ch. 20 - Prob. 24CONQCh. 20 - Prob. 25CONQCh. 20 - 26. What is the difference between an autonomous...Ch. 20 - 1. Briefly explain how McClintock determined that...Ch. 20 - The work of McClintock showed that the presence of...Ch. 20 - 3. In your own words, explain the term transposon...Ch. 20 - Prob. 4EQCh. 20 - 5. Gerald Rubin and Allan Spradling devised a...Ch. 20 - Make a list of the similarities and differences...Ch. 20 - Prob. 2QSDCCh. 20 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain the following pairs of concepts and briefly describe their major difference(s) 1. Recombination fraction & genetic distance.arrow_forwardDescribe step 6 of recombination: Resolution of the Holliday Junctionarrow_forwardAn Hfrstrain that is a *b*c*d* e*f* g *h* is mated with an F strain that is a b e d e f gh. The mating is interrupted at 5 minutes interval, and the genotypes of the F recombinants are determined. The results obtained are tabulated in Table 2. Draw the map of the Hfrchromosome and indicate the position of the origin of transfer, the direction of the transfer and the minutes between genes. Table 2:Entry time of Hfr chromosome into recipient cell. Time a d e f h 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +arrow_forward
- An Hfr strain that is hisE + and pheA + was conjugated to a strain that is hisE − and pheA −. The conjugation was interrupted at different times, and the percentage of recombinants for each gene was determined by streaking on media that lacked either histidine or phenylalanine. The following results were obtained: A. Determine the map distance (in minutes) between these twogenes.B. In a previous experiment, it was found that hisE is 4 minutesaway from pabB and that PheA is 17 minutes from pabB. Drawa genetic map showing the locations of all three genes.arrow_forwardDescribe three examples of specific recombinases that have been discussed in this class. Include a brief description for the function of each specific recombinase.arrow_forwardA molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’arrow_forward
- A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?arrow_forwardSuppose, you want to detect the CAG repeat expansion within a particular gene (30 repeats in normal changes to 250 repeats in disease) in a certain disease. How will you diagnose this disease condition? Can you identify Y chromosome microdeletion (which involves the deletion of AZF locus) using conventional karyotyping? If not, then why? How will you diagnose a chromosomal translocation event? (Discuss any one of the processes)arrow_forwardDescribe the Holliday model and the double-strand break model for homologous recombinationarrow_forward
- In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field, the DNA of the haploid fungus Neurospora crassa (n = 7) moves slowly but eventually forms seven bands, which represent DNA fractions that are of different sizes and hence have moved at different speeds. These bands are presumed to be the seven chromosomes. How would you show which band corresponds to which chromosome?arrow_forwardTo detect the CAG repeat expansion with a particular gene where 30 repeats in Normal changes to 250 repeats in a certain disease, how can we diagnose the condition. How To identify Y chromosome microdeletion ( which involves the deletion of AZF locus) using conventional karyotyping? If not then why. How will you diagnose a chromosomal translocation event?arrow_forwardA pair of paralogous repeats, A and B, have 96% sequence similarity and therefore can promote non-allelic homologous recombination (NAHR). They exist in four possible arrangements in a genome, illustrated below as arrangements 1 – 4. What is the result of NAHR between repeats A and B in arrangement 1? A.Translocation between chromosomes 1 and 2 resulting in monocentric chromosomes B.Deletion or duplication of the region between A and B C.Translocation between chromosomes 1 and 2 resulting in acentric and dicentric chromosomes D.Inversion of the region between A and Barrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license