Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 20, Problem 17CONQ
Summary Introduction
To review:
The characteristics of a TE (transposable element) in chromosomal DNA (deoxyribonucleic acid).
Introduction:
The eukaryotic chromosomes include protein packaging which is done with the help of chaperone proteins, which on binding and condensation of DNA molecule further prevents the molecule from tangling. During cell division in the metaphase, chromosomes are visible if seen through a light microscope.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following questions:
a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain your answer.
b) Would methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove?
The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question:
a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain
b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.
You have sequenced the genome of the bacterium Salmonella typhimurium and find
a protein that is 100 percent identical to a protein in the bacterium Escherichia coli.
When you compare nucleotide sequences of the S. typhimurium and E. coli genes,
you find that their nucleotide sequences are only 87 percent identical. How would
you interpret the observations? Please make sure to select ALL correct answer
options.
Because genetic code is redundant, changes in the DNA nucleotide sequence
can occur without change to its encoded protein.
Due to the flexibility in the third positions of most codons, the DNA sequence
can accumulate changes without affecting protein structure.
Natural selection will eliminate many deleterious amino acid changes. This will
reduce the rate of change in the amino acid sequence and lead to sequence
conservation of the proteins.
Protein sequences are expected to evolve and diverge more slowly than the
genes that encode them.
Chapter 20 Solutions
Genetics: Analysis and Principles
Ch. 20.1 - 1. Homologous recombination refers to the exchange...Ch. 20.1 - During the molecular process of homologous...Ch. 20.1 - 3. A key difference between the original Holliday...Ch. 20.1 - Which of the following mechanisms can cause gene...Ch. 20.2 - 1. During site-specific recombination that occurs...Ch. 20.2 - Prob. 2COMQCh. 20.3 - Which of the following types of transposable...Ch. 20.3 - Prob. 2COMQCh. 20.3 - Prob. 3COMQCh. 20 - 1. Describe the similarities and differences...
Ch. 20 - Prob. 2CONQCh. 20 - 3. Which steps in the double-strand break model...Ch. 20 - Prob. 4CONQCh. 20 - Prob. 5CONQCh. 20 - Prob. 6CONQCh. 20 - Prob. 7CONQCh. 20 - 8. What is gene conversion?
Ch. 20 - Make a list of the differences between the...Ch. 20 - Prob. 10CONQCh. 20 - Prob. 11CONQCh. 20 - 12. According to the double-strand break model,...Ch. 20 - What type of DNA structure is recognized by RecG...Ch. 20 - Briefly describe three ways that antibody...Ch. 20 - 15. Describe the functions of the RAG1 and RAG2...Ch. 20 - According to the scenario shown in Figure 20.7,...Ch. 20 - Prob. 17CONQCh. 20 - Prob. 18CONQCh. 20 - 19. Why does transposition always produce direct...Ch. 20 - 20. Which types of TEs have the greatest potential...Ch. 20 - Prob. 21CONQCh. 20 - 22. Let’s suppose that a species of mosquito has...Ch. 20 - This chapter describes different types of TEs,...Ch. 20 - Prob. 24CONQCh. 20 - Prob. 25CONQCh. 20 - 26. What is the difference between an autonomous...Ch. 20 - 1. Briefly explain how McClintock determined that...Ch. 20 - The work of McClintock showed that the presence of...Ch. 20 - 3. In your own words, explain the term transposon...Ch. 20 - Prob. 4EQCh. 20 - 5. Gerald Rubin and Allan Spradling devised a...Ch. 20 - Make a list of the similarities and differences...Ch. 20 - Prob. 2QSDCCh. 20 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardThe name of the enzyme that cuts the DNA in order to remove a section of broken DNA is called A) ligase B) helicase C) methylase D) nucleasearrow_forwardXeroderma pigmentosum is a genetic disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by ultraviolet light. Studies have shown that it can result from mutations in any one of seven genes. What can you infer from this finding? A) There are seven genes that produce the same protein B) These seven genes are the most easily damaged by ultraviolet light. C) There are seven enzymes involved in the nucleotide excision repair process. D) These mutations have resulted from translocation of gene segments.arrow_forward
- You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…arrow_forwardA geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: — AATTGCCCGATCGATTAAGCCA — Sequence with treatment: — AATTGTTTGATCGATTAAGCTA —arrow_forwardIn addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.arrow_forward
- A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine, guanine, and thymine). (a) How many DNA sequences are exactly 24 letters long? (b) Given a DNA sequence of length 24, how many single letter mutations are possible? (c) Given a DNA sequence of length 24, how many double letter mutations are possible?arrow_forwardScientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What conclusion can you draw? Untreated: ATTCGATTCGCGAA Treated NBW: ATTCGATTCGCGAA Treated LBW: ATTTGATTCGTGAA Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What…arrow_forwardwhy the human dna is considered as a fibonacci sequence?arrow_forward
- A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.arrow_forwardHow is the information in the DNA interpreted into a functional protein,such as an enzyme?arrow_forwardIf a 100 base-pair double-stranded DNA fragment has 40 cytosines, how many adenines does it contain?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license