Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 20, Problem 20.12PS
RNA Non-Interference. You are helping a new student in a lab that studies C. elegans. The student has generated engineered DNA for use in RNAi from genomic DNA for a gene of interest to the lab. She is puzzled that the clone does not have an effect, even though she knows, based on available mutants, that loss of the function of this gene causes worms to die as larvae. You look at the sequence of the DNA she used to make the feeding clone and discover that it corresponds to an intron in the gene. What would you say to the student to explain why her experiment did not succeed?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short
guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently
sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume
that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of
Gene Y is necessary for Gene Ys function.
a. Liver: Functional Gene Y; Brain: Functional Gene Y
b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y
c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y
d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Y
I am more confused. how about we start from begining, you post answers on here, and then we go from there?
1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.
2. "Look carefully at the DNA sequence and identify the start site for transcription"
3.
Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence.
Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein).
Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…
please help me with this question.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.
Chapter 20 Solutions
Becker's World of the Cell (9th Edition)
Ch. 20 - Suppose you are analyzing a haploid E. coli strain...Ch. 20 - How do epigenetic changes, such as DNA...Ch. 20 - Compare the basic state of a gene in bacteria...Ch. 20 - Prob. 1QCh. 20 - Prob. 20.4CCCh. 20 - Prob. 20.1PSCh. 20 - The Pickled Prokaryote. Pickelensia hypothetica is...Ch. 20 - Prob. 20.3PSCh. 20 - Attenuation in 25 or Fewer Words. Complete each of...Ch. 20 - Prob. 20.5PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardtransformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forward
- Yes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in vitro transcription? does rna causes mutations and lose of function of specific genes?arrow_forwardE32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp in length. This DNA contained a eukaryotic promoter for RNA polymerase II. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (see Figure 12.14). For the sample loaded in lane 1, no proteins were added. For the sample loaded in lane 2, the 400-bp fragment was mixed with RNA polymerase II plus TFIID and TFIIB. 2 400 350 250 175 50 Which region of this 400-bp fragment of DNA is bound by RNA polymerase II and TFIID and TFIIB? || III ||| | ||||arrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forward
- An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardPrimer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forward
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardPlease answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forwardRNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY