Concept explainers
(a)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it is located 1000
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(b)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it is in the gene’s coding region.” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(c)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when no promoter is present” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(d)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it causes looping out of the intervening DNA.” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(e)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it causes alternative splicing of the DNA.” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
Want to see the full answer?
Check out a sample textbook solutionChapter 20 Solutions
Becker's World of the Cell (9th Edition)
- Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardYes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in vitro transcription? does rna causes mutations and lose of function of specific genes?arrow_forward
- Part I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardHi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequencearrow_forwardQ34. mRNA decay (breakdown) can play an important role in controlling protein abundance. Which of the following scenarios correctly describes a relationship between mRNA decay and protein abundance? A. A decrease in transcription with an increase in the rate of mRNA decay can result in increased protein abundance. B. An increase in transcription with an increase in the rate of mRNA decay can result in no change in protein abundance. C. An increase rate of protein synthesis but failure to form an apoprotein can be explained by a decrease in mRNA decay. D. None of the abovearrow_forward
- Transcriptional regulation You are interested in studying the transcriptional regulation of Glp1 promoter. This gene contains a binding site for two proteins A and B. Proteins A and B cannot bind to the DNA at the same time due to steric interference caused by a slight overlap in their binding sites. The binding sites of protein A and protein B can be seen in the figure below. Protein A binds to Site C and Protein B binds to site D. To assess whether either A or B have an influence on Glp1 expression, you create mutations in the DNA that selectively remove the non-overlapping sequences of binding site C or binding site D. You then examine Glp1 mRNA production within adult liver cells. You receive the following data. Experiment number Binding site C Binding site D Glp1 mRNA levels 1 + + high 2 + - high 3 - + none 4 - - none += binding site present, -= binding site absent What does this data tell us about which protein is…arrow_forwardPlz answer ASAP. I will thumb up You are studying the regulation of the lactose operon in Escherichia coli, by measuring expression of the lacZ gene (i.e production of beta-galactosidase).(a) You identify several loss-of-function mutations in which lacZ is never expressed, in the presence and absence of glucose and lactose. What components of the lac operon could be mutated to produce this phenotype? List all possibilities.arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- Learning activity 5 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what sequence of bases would appear in MRNA transcribed from this segment b.) assume that the first base in this MRNA is the beginning of a codon. What order of amino acids would be translated into a polypeptide synthesized along this segment? c.) give anticodons for each tRNA associated with the translation in part (b)arrow_forwardTranscription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2arrow_forwardComplements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education