Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 20, Problem 20.9PS
Homeotic Genes in Drosophila. Homeotic genes are considered crucial to early development in Drosophila because … (Indicate true or false for each statement, and explain your answer.)
(a) … they encode proteins containing zinc finger domains.
(b) … mutations in homeotic genes are always lethal.
(c) … they control the expression of many other genes required for development.
(d) … homeodomain proteins act by influencing mRNA degradation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
GTTTTCACTGGCGAGCGTCATCTTCCTACT
8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Research cancer mutation. Provide the link to the research article that gives you your information. One good resource to use is PubMed. Then answer the following questions, in 3 paragraphs, 3-5 sentences each.
1. What kind of disease/cancer does this mutation cause?
2.What happens during transcription to cause this mutation?
3. Is this trait passed on to progeny? Can the progeny be a carrier or simply affected?
Can you please help with 1a,1b, and 1c please
1a. Find a paper published in a scientific journal between January 2018 and September 2022 that addresses the role of an example of histone modification in affecting expression of a gene by altering histone acetylation/chromatin state of the DNA encoding that gene. What organism and/or cell type did the authors do their study in?
1b. Which histone(s) were affected by the acetylation and/or deacetylation? What gene did they show had altered expression levels in response to the change in histone acetylation?
1c. what effect did the histone modification they studied have on that gene's level of expression - was expression of the gene they examined increased or decreased?
Chapter 20 Solutions
Becker's World of the Cell (9th Edition)
Ch. 20 - Suppose you are analyzing a haploid E. coli strain...Ch. 20 - How do epigenetic changes, such as DNA...Ch. 20 - Compare the basic state of a gene in bacteria...Ch. 20 - Prob. 1QCh. 20 - Prob. 20.4CCCh. 20 - Prob. 20.1PSCh. 20 - The Pickled Prokaryote. Pickelensia hypothetica is...Ch. 20 - Prob. 20.3PSCh. 20 - Attenuation in 25 or Fewer Words. Complete each of...Ch. 20 - Prob. 20.5PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- "Schematic outline of melanogenesis. UVR stimulates the expression of POMC by keratinocytes. The peptide produced is the precursor of the hormone a-MSH, that binds to MC1R in melanocytes. This union leads to an increase in cellular cyclic adenosine monophosphate (cAMP) that in turn leads to increased levels of MITF expression, which upregulates the transcription of TYR, TYRP1 and TYRP2, producing brown-black eumelanin. In the absence of a-MSH, the antagonist ASIP binds to MC1R, and phaeomelanin is synthetized instead. Melanosomes are then transferred to keratinocytes through the dendrites via a shedding vesicle system." Briefly discuss how these several aspects of the molecular and cellular biology of melanin production and melanosome transfer contribute to determine skin color. How would different mutations in the hormonal response to ultraviolet light, the melanin production signal transduction pathways, and melanosome transfer influence skin color, hair color, and eye color? Did…arrow_forwardGenetic instability in the form of point mutations, chromosome rearrangements, andepigenetic changes needs to be maximal to allow the development of cancer.(a) With diagrams explain:(i) point mutations (ii) chromosome rearrangement (iii) epigenetic changesarrow_forwardVARIATIONS IN GENE EXPRESSION In humans, the glucose-6-phosphate dehydrogenase (G6PD) gene involved in sugar metabolism is X-linked. The dominant allele (G) codes for fast enzymes for normal cell functioning while the recessive allele (g) codes for slow enzymes, which are responsible for the reduced enzymatic activity of cells. However, the presence of slow enzymes has minimal effect in the overall functioning of heterozygotes, thus normal. Recessives, however, are more prone to oxidative reactions that speed up the cell damaging process, thus weak (but not lethal). If random inactivation occurs during dosage compensation, what would be the genotypes and phenotypes of the children of a heterozygous mother and a recessive father? Show COMPLETE cross.arrow_forward
- Variations in Gene Expression In humans, the glucose-6-phosphate dehydrogenase (G6PD) gene involved in sugar metabolism is X-linked. The dominant allele (G) codes for fast enzymes for normal cell functioning while the recessive allele (g) codes for slow enzymes, which are responsible for the reduced enzymatic activity of cells. However, the presence of slow enzymes has minimal effect in the overall functioning of heterozygotes, thus normal. Recessives, however, are more prone to oxidative reactions that speed up the cell damaging process, thus weak (but not lethal). If random inactivation occurs during dosage compensation, what would be the genotypes and phenotypes of the children of a heterozygous mother and a recessive father? with COMPLETE crossarrow_forwardPolarity of oocyte of DrosophilaWhat are the cells surrounding the oocyte? Are they germ-line or somatic in origin?arrow_forwardLunatic fringe (Lfng) expression in Examine the figure and answer these questions: WT and DLL3pu mouse embryos wt DII3pu a wt d DI13 1.1 Compare the expression pattern of Lfng in one period of somitogenesis between the WT and DI13Pu mutants (panels a-f), where is the gene expressed and what is different? (3 points) 1.2 In panels g and h, the embryo was bisected and one side fixed right away and the other incubated for ½ of a single somitogenesis cycle. Compare the change in Lfng expression in the two genotypes at time 0 and time +45. What can we conclude from this experiment? (2 points) garrow_forward
- Gene Interaction and Epistasis Hair color is due to the presence of melanin. There are two types of melanin produced by melanocytes. One is eumelanin, which is responsible for black (homozygous), brown (heterozygous), and blond (recessive) hair colors. The other is pheomelanin, which is responsible for red hair color. During melanin synthesis, MCR1gene converts pheomelanin to eumelanin. However, a variant of the MCR1 gene (MCR1variant), prevents this conversion. A cross between a blond-haired mother and a red-haired father produced 100% brown-haired children. When they came of age, one child married a double heterozygote, and both were blessed with 7 children; 2 with black hair, 2 with brown hair, 1 with blond hair, and 2 with red hair. Using the 7-step method, determine the genotypes of the P1, the F1, and the F2s. BOX your answers (if handwritten) or HIGHLIGHT your answers (if encoded). STEP 1: ________________________________________________________ STEP 2:…arrow_forwardMacmillan Learning across generations. Place the events in the order necessary for an epigenetic modification to be inherited in the next generation. $ 4 900 F4 Certain CpG methylation sites are not erased during gametogenesis or embryogenesis. DNA methyltransferase recognizes and binds CpG sites on DNA. A methyl group is added to the cytosine residue of the DNA sequence. DNA methyltransferase maintains the methylation pattern on both DNA strands. % Recent studies have found instances of transgenerational inheritance of epigenetic traits in humans (Relton et al., 2012 already possess their eggs at birth whereas males do not produce sperm until nuberty For enigenetic modifications to 5 F5 ^ Methylated CpG sites on one inherited DNA strand 6 Epigenetic silencing passed to offspring F6 MacBook Air Answer Bank & 7 F7 * 8 DII. F8 DD F9 F10 J F11 Uarrow_forwardWhich statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.arrow_forward
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.arrow_forwardPlease help me with this question. More than one answer may be correct. A greater number of protocadherin genes ____. Options: A) are found in Drosophila than humans B) were the precursors to megacadherin, which eventually defeated Dr. Wily C) are present in vertebrates than classical cadherin genes D) are associated with larger brains E) are found in octopuses than humansarrow_forwardPart I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY