In the experiment below, flasks of human fibroblasts are either transfected with a control gene or the v-src gene. After 48 hrs the flasks (Top row) as well as microscope images of cells on surface of flask (bottom row) from the two different experiments are depicted. Which Flask (A or B) is from the v-src transfection? Justify in 3-4 sentences why you drew this conclusion. Flask A Flask B ium

To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…

Bacterial systems serve as an excellent model to express proteins but has a disadvantage – what is that disadvantage? List the points to differentiate three classes of restriction enzymes? Give an example of restriction enzyme that has ability to generate blunt and cohesive ends after digestion of DNA?

Determine the coefficient of coincidence and the interference

In E. coli, the gene bioD+ encodes an enzyme involved in biotin synthesis, and galK+ encodes an enzyme involved in galactose utilization. An E. coli strain that contained wild-type versions of both genes was infected with P1 phage, and then a P1 lysate was obtained. This lysate was used totransduce (infect) a strain that was bioD− and galK−. The cellswere plated on a medium containing galactose as the sole carbonsource for growth to select for transduction of the galK+ gene.This medium also was supplemented with biotin. The resultingcolonies were then restreaked on a medium that lacked biotin tosee if the bioD+ gene had been cotransduced. The following resultswere obtained:What information do you know based onthe question and your understanding of the topic?

3 2. The table below was obtained by P1 phage transduction followed by media selection of an E. coli strain lacking the three genes. Determine the map order of the genes given the information provided. Demonstrate CLEARLY which are closer or farther from each other (no numbers needed). 1 2 MAP: Experiment Selected marker Ala+ Gly+ Ser+ Unselected markers (select- ed for by subsequent plating) 27% Ser+, 2% Gly+ 3% Ser+, 1% Ala+ 35% Ala+, 4% Gly+

Have a look at the results in this SDS-PAGE gel. A MW ladder is shown. In the "control" lane, a sample of recombinant protein "LBT3" was loaded. Lane A shows proteins that have been prepared from leukocytes from a normal, healthy individual. Lanes B, C, D, E and F show protein prepared from leukocytes from individuals with lymphoma. What is the best explanation for the result shown for patient D? 200 150 100 75 50 37 20 Weight, kDa MW ladder Control A

In a generalized-transduction experiment, phages arecollected from an E. coli donor strain of genotype cys+leu+ thr+ and used to transduce a recipient of genotypecys- leu- thr-. Initially, the treated recipient populationis plated on a minimal medium supplemented with leucine and threonine. Many colonies are obtained.a. What are the possible genotypes of these colonies?b. These colonies are then replica plated onto threedifferent media: (1) minimal plus threonine only, (2)minimal plus leucine only, and (3) minimal. Whatgenotypes could, in theory, grow on these three media?c. Of the original colonies, 56 percent are observed togrow on medium 1, 5 percent on medium 2, and nocolonies on medium 3. What are the actual genotypes ofthe colonies on media 1, 2, and 3?d. Draw a map showing the order of the three genes andwhich of the two outer genes is closer to the middle gene

Read the statements below and determine which f the recombination mechanisms that it matches with - there could be more than one match or there could be no match at all. For each box, place a YES or NO in the box. Statement 1. Donor cell produces a pilus in order to exchange DNA with recipient cell. 2. Mediated by a bacteriophage. 3. Always involves a plasmid. 4. Allows recombination of chromosomal DNA fragments from donor to recipient. 5. Requires rolling circle replication. 6. Requires donor to recipient cell direct contact. 7. Allows the uptake of free DNA fragments from the environment. 8. Is always horizontal gene exchange. 9. Allows movement of genes from a plasmid to a chromosome. 10. Requires a donor cell to infect a recipient cell in order for recombination to occur. 11. Involves plasmid integration into the chromosome prior to recombination. 12. Involves incorrect packaging of donor DNA into a phage particle in order for recombination to occur. 13. Involves DNA that was…

Experiment 1: An RT-PCR was run on human cells growing in tissue culture under standard conditions, using the primers described above. A normal PCR was also run on the cells, using the same primers. They were run on an agarose gel shown on the left in the figure (gel 1), in the wells indicated by ‘RT-PCR’ and ‘PCR’. The arrow shows the direction of current in the gel. a) Observe the gel and describe the results for the RT-PCR and PCR (no explanation, just describe). b) Explain why the bands have travelled different distances on the gel.