Concept explainers
DNA Structure. Carefully inspect the double-stranded DNA molecule shown here, and notice that it has twofold rotational symmetry:
Label each of the following statements as T if true or F if false.
- (a) There is no way to distinguish the right end of the double helix from the left end.
- (b) If a solution of these molecules were heated to denature them, every single-stranded molecule in the solution would be capable of hybridizing with every other molecule.
- (c) If the molecule were cut at its midpoint into two halves, it would be possible to distinguish the left half from the right half.
- (d) If the two single strands were separated from each other, it would not be possible to distinguish one strand from the other.
- (e) In a single strand from this molecule, it would be impossible to determine which is the 3′ end and which is the 5″ end.
Want to see the full answer?
Check out a sample textbook solutionChapter 16 Solutions
Becker's World of the Cell (9th Edition)
- VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardRead it carefully.. Draw only correct diagrams.. In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C). 1. Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction. 2. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.arrow_forward
- Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stackingarrow_forwardCompare and contrast the structure of DNA and RNA. Be sure to describe each of the three components of a nucleotide for both DNA and RNA along with the types of bonds formed between the components. In addition, explain: how the nucleotides link together to form each molecule, why the prime ends are labeled 5’ and 3’, what antiparallel is, what phospodiester linkages are and what complementary base pairing is.arrow_forwardDNA Structure A. Draw an A-T base pair with the appropriate number of hydrogen bonds. You don’t have to include all the details such as every side-group but do depict the 3’ OH groups. B. What is meant by anti-parallel when referring to a DNA molecule? C. What are the major and minor grooves in the DNA structure and what significance do they have?arrow_forward
- DNA contents of nitrogenous bases • %A = %T %C = %G • A+G = C+T %3D Example: if 35% of the bases of a DNA - molecule is thymine what the % of Cyosine?arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward. Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on double-stranded DNA. It has been observed that treatment of nucleosomal core particles with DNase I yields a peculiar result. When DNA from such a digestion is electrophoresed under denaturing conditions, the single-stranded fragments are observed to occur in a regular periodicity of about 10 bases. Suggest an explanation of this result in terms of the structure of the nucleo- some.arrow_forward
- Question 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forwardA. Draw a detailed structure of DNA strand using the following sequence of bases 5'A -C- G 3' Show the structure of the phosphate group, pentose sugar and nitrogen containing base B. Why is DNA called the blueprint of an organism?arrow_forwardTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning