Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 2P
The human genome is
How many fragments would be predicted to result from the complete digestion of the human genome with the following enzymes: Sau
How would your initial answer change if you knew that the average GC content of the human genome was
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In not more than 200 words, explain how the human genome of 3.4 Gb would be in 2.3 meters long when stretched linearly if this size is fit into a cell of minuscule proportions.
By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule?
(1/4)^6 * 10,000 = 2.44140625 => 2.4
For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb)
Please answer asap and type your answer and do not copy from anywhere please
The human genome (3.4 Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell of minuscule proportions.
Chapter 15 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 15 - 15.1 What purpose do the bla and lacZ genes serve...Ch. 15 - The human genome is 3109 bp in length. How many...Ch. 15 - 15.3 Ligase catalyzes a reaction between the...Ch. 15 - You have constructed four different libraries: a...Ch. 15 - Using the genomic libraries in Problem 4, you wish...Ch. 15 - The human genome is 3109bp. You wish to design a...Ch. 15 - 15.7 Using animal models of human diseases can...Ch. 15 - 15.8 Compare methods for constructing homologous...Ch. 15 - 15.9 Chimeric genefusion products can be used for...Ch. 15 - 15.10 Why are diseases of the blood simpler...
Ch. 15 - Injection of double-stranded RNA can lead to gene...Ch. 15 - Compare and contrast methods for making transgenic...Ch. 15 - 15.13 It is often desirable to insert cDNAs into a...Ch. 15 - 15.14 A major advance in the s was the development...Ch. 15 - 15.15 The bacteriophage lambda genome can exist in...Ch. 15 - 15.16 The restriction enzymes Xho and Sal cut...Ch. 15 - 15.17 The bacteriophage has a single-stranded DNA...Ch. 15 - 15.18 To further analyze the CRABS CLAW gene (see...Ch. 15 - You have isolated a genomic clone with an EcoR I...Ch. 15 - 15.20 You have identified a cDNA clone that...Ch. 15 - 15.21 You have isolated another cDNA clone of the...Ch. 15 - 15.22 You have identified five genes in S....Ch. 15 - You have generated three transgenic lines of maize...Ch. 15 - 15.24 Bacterial Pseudomonas species often possess...Ch. 15 - 15.25 Two complaints about some transgenic plants...Ch. 15 - 15.26 In Drosophila, lossoffunction Ultrabithorax...Ch. 15 - Prob. 27PCh. 15 - The highlighted sequence shown below is the one...Ch. 15 - Vitamin E is the name for a set of chemically...Ch. 15 - The RAS gene encodes a signaling protein that...Ch. 15 - 15.31 You have cloned a gene for an enzyme that...Ch. 15 - 15.32 About of occurrences of nonautoimmune type...Ch. 15 - Describe how having the Cas 9 gene at a genomic...Ch. 15 - 15.34 Would a gene drive system spread rapidly...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Alu 1 enzyme comes at a concentration of 5,000 U/ml. Its buffer comes 10X. The DNA is at a concentration of 4 ug/ul. You are ordered to do a digestion reaction of 12 ug of DNA in a total volume of 25 ul. You should use 1 U/ug of DNA. a) In what volume will you get them? b) How will you dispense them? c) Prepare the following table with the reactants of the reaction: Buffer _______ul DNA ______ug _______ul Enzyme ______U _______ul Water _______ularrow_forwardThe BamH1 enzyme comes at a concentration of 100,000 U/ml. You are asked to digest 20 ug of DNA with this enzyme. Determine: a) How many units will you need? b) How will you dispense them?arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forward
- E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long? This requires knowing how many nucleotides of DNA code for one amino acid. F. Assuming that there are between 20,000-25,000 genes in the human genome, do you think there are 1) fewer, 2) approximately the same number, or 3) more proteins in the human genome? Explain your answer.arrow_forwardWhat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)arrow_forwardThe DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forward
- A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.arrow_forwardThe human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell if minuscule proportionsarrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forward
- Assume that a DNA sequencing reaction is carried out, except that the four different dideoxyribonucleoside triphosphates are modified so that each contains a covalently attached dye of a different color (which does not interfere with its incorporation into the DNA chain). What would the products be if you added a mixture of all four of these labeled dideoxyribonucleoside triphosphates along with the four unlabeled deoxyribonucleoside triphosphates into a single sequencing reaction? What would the results look like if you electrophoresed these products in a single lane of a gel?arrow_forwardSuppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal determination, a biochemist found out that there are two N-terminal amino acid residues, V and G. What is the original sequence of the protein given the following peptide fragments: after digestion with Chymotrypsin: G-L-S-R-G-M-w V-A-L-F Q-L-Y L-R-V-W G-M-V-E-A-D-I-P K-S-P-E-M-T-W R-M-A-S-E-K-P-G-H after digestion with Trypsin: P-G-H V-W-G-M-V-E-A-D-I-P M-A-S-E-K G-M-W-Q-L-Y-L-R S-P-E-M-T-W-R G-L-S-R V-A-L-F-K after digestion with Cyanogen Bromide: T-W-R-M W-Q-L-Y-L-R-V-W-G-M V-E-A-D-I-P A-S-E-K-P-G-H V-A-L-F-K-S-P-E-M G-L-S-R-G-Marrow_forwardFrom the complete genome sequence of an organism, you have determined the following percentages of each nucleotide: Adenine (20); Cytosine (30) Guanine (30); Thymine (20). The mol% G + C for this organism isarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License