Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 25PDQ
DNA methylation is commonly associated with a reduction of transcription. The following data come from a study of the impact of the location and extent of DNA methylation on gene activity in human cells. A bacterial gene, luciferase, was cloned next to eukaryotic promoter fragments that were methylated to various degrees, in vitro. The chimeric plasmids were then introduced into tissue culture cells, and the luciferase activity was assayed. These data compare the degree of expression of luciferase with differences in the location of DNA methylation(Irvine et al., 2002. Mol and Cell Biol 22: 6689–6696). What general conclusions can be drawn from these data?
DNA Segment | Patch Size of Methylation (kb) |
Number of Methylated CpGs | Relative Luciferase Expression |
Outside transcription | 0.0 | 0 | 490
|
unit (0–7.6 kb away) | 2.0 | 100 | 290
|
3.1 | 102 | 250
|
|
12.1 | 593 | 2
|
|
Inside transcription unit | 0.0 | 0 | 490
|
1.9 | 108 | 80
|
|
2.4 | 134 | 5
|
|
12.1 | 593 | 2
|
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.
How do you think that transcription randomizes positions of nucleosomes and repression restores the ordering after transcription?
How might you test to see if there was an exchange of histone subunits during transcription or if the nucleosome is truly transferred as a single unit?
Would you expect the DNA band representing the distance from the restriction enzyme site to the hypersensitive site to be a single band or a smear? Defend your answer.
The restriction digests of the cloned Drosophila gene can provide direct visible evidence of a mutation, as these samples come from a clone of the gene. In order to similarly detect a mutation in the copy of the endogenous gene within the Drosophila genome, a mechanism for specifically detecting restriction fragments from that gene among the complex set of fragments generated in a restriction digest of the entire Drosophila genome. Remember that the Drosophila melanogaster genome consists of ~123,000 kb.
For a 10.2 kb Drosophila gene, what fraction of the genome does this gene constitute?
Chapter 15 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 15 -
CASE STUDY | A mysterious muscular dystrophy
A...Ch. 15 -
CASE STUDY |A mysterious muscular dystrophy
A...Ch. 15 -
CASE STUDY |A mysterious muscular dystrophy
A...Ch. 15 -
HOW DO WE KNOW?
1. In this chapter, we have...Ch. 15 -
2. Review the Chapter Concepts list on p. 280....Ch. 15 - Describe which enzymes are required for lactose...Ch. 15 - Contrast positive versus negative regulation of...Ch. 15 -
5. Both attenuation and riboswitches rely on...Ch. 15 - For the lac genotypes shown in the accompanying...Ch. 15 -
7. For the genotypes and conditions (lactose...
Ch. 15 -
8. The locations of numerous lacI– and lacIs...Ch. 15 - Explain why catabolite repression is used in...Ch. 15 - Describe experiments that would confirm whether or...Ch. 15 - Predict the level of genetic activity of the lac...Ch. 15 - Predict the effect on the inducibility of the lac...Ch. 15 -
13. Describe the role of attenuation in the...Ch. 15 -
14. In a theoretical operon, genes A, B, C, and D...Ch. 15 - A bacterial operon is responsible for production...Ch. 15 - A marine bacterium is isolated and is shown to...Ch. 15 -
17. Why is gene regulation more complex in a...Ch. 15 -
18. List and define the levels of eukaryotic gene...Ch. 15 -
19. Distinguish between the cis-acting regulatory...Ch. 15 - Prob. 20PDQCh. 15 - Compare the control of gene regulation in...Ch. 15 - Many eukaryotic promoter regions contain CAAT...Ch. 15 -
23. What is RNA-induced gene silencing in...Ch. 15 - Although it is customary to consider...Ch. 15 - DNA methylation is commonly associated with a...Ch. 15 - The interphase nucleus appears to be a highly...Ch. 15 - It has been estimated that at least two-thirds of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forwardAfter Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNAarrow_forwardSuppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a product called peptide Y. A region of gene Y contains the DNA sequence ATG-CGC-GAA-CTG-GTG-AAC-TAA. The researcher wishes to change a Val residue to an Ala residue in this region of peptide Y using site-directed mutagenesis. What should be the sequence of the mutant oligonucleotide primer in this region? You may use a codon table. mutant oligonucleotide primer sequence: GGC-GGC-GAA-CTG-GTG-AAC-TAA Incorrectarrow_forward
- A series of exonuclease deletions were used to study the promoter of the rice hemA gene, giving the results shown below (the intact promoter is on top). Based on these results, what conclusions could you draw from each of the deletion construct, and what do you know about the nature of the promoter? Relative activity -500 Reporter gene 100% Reporter gene 180% -350 -250- Reporter gene 180% 75% -150 Reporter gene 45% Reporter gene -100 0% - 8 Reporter genearrow_forwardA scientist seeks to synthesize a blood clotting factor protein in lab. To perform this experiment,she utilizes recombinant DNA technology where she inserts the gene of interest encoding for theparticular protein from a eukaryotic cell into bacterial plasmids. These plasmids are thesetransformed into E.coli for expression. During structural elucidation of the product, she isdisappointed to discover that the gene product from the bacteria is not the correct protein. Whatcorrective step could she take in the procedure to fix this issue? Justify your answer.arrow_forwardIn Northern blot analysis, mRNA samples from tissues are bound to a labeled DNA probe that is complementary to the mRNA, and run on a gel to be visualized. The protein tropomyosin is known to be present in both brain and liver. When brain and liver tissue were assayed for the presence of tropomyosin mature mRNA, bands of two different sizes were seen. Tropomyosin gene diagram (3000 bp total): Shown in attatched image If the band on the Northern blot for mRNA isolated from liver tissue is 2580 bp, whereas from brain tissue the band is 2250 bp, what is most likely? a)The two mRNAs are made from different tropomyosin DNA sequences. b)Exon 2 is alternatively spliced out of the brain mRNA. c)Introns 1 and 2 are spliced out of the brain transcript but not the liver transcript. d)Exons 1 and 3 are spliced out of the brain transcript but not the liver transcript. e)Exon 2 is alternatively spliced out of the liver mRNA.arrow_forward
- A rice MADS box transcription factor gene contains a number of sequences that are removed in the processing of the mRNA transcript. Bacterial cells cannot excise these sequences from mRNA transcripts, yet via recombinant DNA technology, this gene can be cloned into a bacterial cell and produce the MADS box factor protein. Explain how this is possible.arrow_forwardTo identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesarrow_forwardDNA supercoiling, which occurs when coiling tension is generated ahead of the replication fork, is relieved by DNA gyrase. Supercoiling may also be involved in transcription regulation. Researchers discovered that enhancers operating over a long distance (2500 bp) are dependent on DNA supercoiling, while enhancers operating over shorter distances (110 bp) are not so dependent [Liu et al. (2001). Proc. Natl. Acad. Sci. USA 98:14,883–14,888]. Using a diagram, suggest a way in which supercoiling may positively influence enhancer activity over long distances.arrow_forward
- DNA precursor imbalances are mutagenic. For example, if dGTP accumulates, it can compete with dATP for incorporation opposite dTMP in the template, leading to a transition mutation. Investigators have shown that a modest balanced increase in all four dNTPs, three- or fourfold, stimulated mutagenesis out of proportion to the dNTP pool change. Describe a mechanism by which this could occur.arrow_forwardDNA polymerases are capable of editing and error correction, meaning it is able to edit and correct single base error so that the gene is not affected. However, RNA polymerase has a limited capacity for error correction. Given that a single base error in either replication or transcription can lead to error in protein synthesis, suggest a brief explanation for this difference in the capability of error correction between DNA polymerase and RNA polymerase.arrow_forwardWhich of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY