After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNA

After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNA

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?
To identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genes
A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: If recombinant cells were plated on medium containingampicillin or tetracycline and medium withboth antibiotics, on which plates would you expectto see growth of bacteria containing plasmids withDrosophila DNA inserts?
A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: Which antibiotic should be added to the mediumto select cells that have incorporated a plasmid?
You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'
After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG…
STEP BY STEP Exaplanation would be appreciated so I can understand for upcomming exam. In humans, the COL1A1 locus codes for a collagen protein found in bone. A recessive COLA1 allele believed to reduce bone density and increase risk of fractures differs from the wild type allele by the presence a GT in the first intron of the gene. This mutation can be easily screened by PCR, using COL1A1-specific primers followed restriction enzyme digest of the product with MscI. The normal allele is denoted as G and the recessive allele as T. A recent study of 894 women found that 570 were GG, 291 were GT and 33 were TT. (Assume for this exercise that these values reflect both male and female values for the sampled population. What are the frequencies of each allele? What are the frequencies of each genotype? c. Is this locus in Hardy-Weinberg equilibrium? Use the table below to evaluate the significance of any deviation from H-W expectations.
Arabidopsis thaliana has among the smallest genomes in higher plants, with a haploid genome size of about 100 Mb. If this genome is digested with BbvCl, a restriction enzyme which cuts at the sequence CCTCAGC GGAGTCG 1. approximately how many DNA fragments would be produced? Assume the DNA has a random sequence with equal amounts of each base.
Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesis
A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: How can you explain the presence of colonies thatare resistant to both antibiotics?
The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…
In generating mutations in a bacterial gene involved in antibiotic resistance, a number of point mutations are isolated that render the bacteria sensitive to the antibiotic. You would like to sequence the gene in order to characterize the mutations, but unfortunately, your lab partner just finished the last of the lab's supply of DNA polymerase. The only things at your disposal are materials for performing a western blot, allowing you to visualize the protein encoded by the gene. How would you identify which mutations are likely to be the result of a missense mutation, which are likely to be the result of a nonsense mutation, and which are likely to be the result of a frameshift mutation?