Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 20QP
Analyzing Cloned Sequences
A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Describe what each of the 12 bands on your Western blot should have been. Remember, the 12 bands will be 4 conditions x 3 proteins (phospho-S6, phospho-AMPK, tubulin). Please describe the relative density of each band compared to the control (for example, how dense will phospho-S6 be in each of the three experimental conditions compared to the control condition?). For each band, provide a well-reasoned rationale for your anticipated result. Give the reason why cell signaling would produce each result in each condition.
Clone number in this case is number 196 which is shown in the images.
State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector
band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)
In the Western blot shown here, proteins were isolated from redblood cells and muscle cells from two different individuals. Oneindividual was unaffected, and the other suffered from a diseaseknown as thalassemia, which involves a defect in hemoglobin. Theblot was exposed to an antibody that recognizes β globin, whichis one of the polypeptides that constitute hemoglobin. Equal totalamounts of cellular proteins were added to each lane.
Explain these results.
Chapter 13 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 13.5 - Do you think the way this issue was handled should...Ch. 13.5 - Prob. 2EGCh. 13.7 - If you were offered the chance to have the genome...Ch. 13.7 - Prob. 2EGCh. 13 - Improving the nutritional value of food has long...Ch. 13 - Improving the nutritional value of food has long...Ch. 13 - Prob. 3CSCh. 13 - What Are Clones? Cloning is a general term used...Ch. 13 - Prob. 2QPCh. 13 - Prob. 3QP
Ch. 13 - Prob. 4QPCh. 13 - Prob. 5QPCh. 13 - Prob. 6QPCh. 13 - Cloning Genes Is a Multistep Process The following...Ch. 13 - Prob. 8QPCh. 13 - Prob. 9QPCh. 13 - Cloning Genes Is a Multistep Process Which enzyme...Ch. 13 - Cloning Genes Is a Multistep Process In cloning...Ch. 13 - Prob. 12QPCh. 13 - Prob. 13QPCh. 13 - Prob. 14QPCh. 13 - Prob. 15QPCh. 13 - Cloned Libraries You are running a PCR to generate...Ch. 13 - Prob. 17QPCh. 13 - Prob. 18QPCh. 13 - Prob. 19QPCh. 13 - Analyzing Cloned Sequences A base change (A to T)...Ch. 13 - Prob. 21QPCh. 13 - Analyzing Cloned Sequences What kind of...Ch. 13 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You observe the following: Your Your friend's Gel Gel 120 kDa 100 kDa 120 kDa 100 kDa -80 kDa 80 kDa -40 kDa 40 kDa a. You and your friend analyzed the same protein sample in your gels. Why are your results different? Explain briefly which gel is the correct representation of the SDS-PAGE & Western blot, and why? b. Explain briefly the size of protein observed in the chromatography column and the Western blot. Are they different or the same, why? (S c. If the primary antibody to Protein A was made in a mouse, describe the details of the secondary antibody used in the Western blot analysis?arrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forwardIn this western blot, the levels of phosphorylated TBK (PTBK) decrease with increasing amounts/expression of the viral protein (VP). Figure description: Increasing amounts of a plasmid expressing the viral protein (0.5, 1, or 2ug) were cotransfected with TBK1 expression plasmid. Cells were harvested 24 h post-transfection and analyzed for phosphorylated TBK1 (anti- TBK1 Ser172), total TBK1 (anti-TBK1), B-actin (anti-B-actin), and viral protein (anti-VP) expression by Western blot analysis. VP PTBK1 (S172) TBK1 actin Virus proteins O True O Falsearrow_forward
- Choose two genes from Figure 4.6 and draw a graph to represent the change in transcription over time.arrow_forward7. Consider the following plasmid (size 6700 bp), with restriction sites at the positions indicated: BamHI + 1 6700 bp 2800 3500 EcoRI BamHI Probearrow_forwardDNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA fragments were separated by gel clectrophoresis, transferred to a membrane, and hybridized with a 12 kb 10 kb DNA probe complementary to a region between sites C and D (see 8 kb hybridization line). The image of the southern blot shows the labeled DNA bands and 6 kb molecular weight (MW) markers. The lane labels I, II, III, and IV -5 kb correspond to individuals I, II, III, and IV. Assume that fragments such as C-D and C-E are clearly resolved in this gel system. Fragment sizes are as given: A-B is 4 kb, B-C is I kb, C-D is 5 kb, and D-E is 650 bp. Individual I has five cleavage sites (A, B, C, D, and E) for the restriction endonuclease. DNA homologous to probe Which individual has at least one point mutation that eliminates restriction site C only? O II IV cannot be determined II Which individual has at least one point mutation that climinates restriction sites B and C? III O IV cannot be…arrow_forward
- In Northern blot analysis, mRNA samples from tissues are bound to a labeled DNA probe that is complementary to the mRNA, and run on a gel to be visualized. The protein tropomyosin is known to be present in both brain and liver. When brain and liver tissue were assayed for the presence of tropomyosin mature mRNA, bands of two different sizes were seen. Tropomyosin gene diagram (3000 bp total): Shown in attatched image If the band on the Northern blot for mRNA isolated from liver tissue is 2580 bp, whereas from brain tissue the band is 2250 bp, what is most likely? a)The two mRNAs are made from different tropomyosin DNA sequences. b)Exon 2 is alternatively spliced out of the brain mRNA. c)Introns 1 and 2 are spliced out of the brain transcript but not the liver transcript. d)Exons 1 and 3 are spliced out of the brain transcript but not the liver transcript. e)Exon 2 is alternatively spliced out of the liver mRNA.arrow_forwardYou have isolated a cDNA clone encoding a protein of interest in a higher eukaryote. This cDNA clone is not cleaved by restriction endonuclease EcoRI. When this cDNA is used as a radioactive probe for blot hybridization analysis of EcoRI-digested genomic DNA, three radioactive bands are seen on the resulting Southern blot. Does this result indicate that the genome of the eukaryote in question contains three copies of the gene encoding the protein of interest? Explain.arrow_forwardSTEP BY STEP Exaplanation would be appreciated so I can understand for upcomming exam. In humans, the COL1A1 locus codes for a collagen protein found in bone. A recessive COLA1 allele believed to reduce bone density and increase risk of fractures differs from the wild type allele by the presence a GT in the first intron of the gene. This mutation can be easily screened by PCR, using COL1A1-specific primers followed restriction enzyme digest of the product with MscI. The normal allele is denoted as G and the recessive allele as T. A recent study of 894 women found that 570 were GG, 291 were GT and 33 were TT. (Assume for this exercise that these values reflect both male and female values for the sampled population. What are the frequencies of each allele? What are the frequencies of each genotype? c. Is this locus in Hardy-Weinberg equilibrium? Use the table below to evaluate the significance of any deviation from H-W expectations.arrow_forward
- In this western blot, the levels of actin increase with increasing amounts/expression of the viral protein (VP). Figure description: Increasing amounts of a plasmid expressing the viral protein (0.5, 1, or 2ug) were cotransfected with TBK1 expression plasmid. Cells were harvested 24 h post-transfection and analyzed for phosphorylated TBK1 (anti-PTBK1 Ser172), total TBK1 (anti-TBK1), B-actin (anti-ß-actin), and viral protein (anti-VP) expression by Western blot analysis. VP PTBK1 (S172) TBK1 actin Virus proteins O True O Falsearrow_forwardHow many restrictions sites are present in the EcoRI. Calculate the number of restriction sites for EcoRI in 12689000kb moleculearrow_forwardGenomic DNA from a family where sickle-cell disease is known to be hereditary, is digested with the restriction enzyme MstII and run in a Southern Blot. The blot is hybridised with two different 0.6 kb probes, both probes (indicated in red in the diagram below) are specific for the β-globin gene (indicated as grey arrow on the diagram below). The normal wild-type βA allele contains an MstII restriction site indicated with the asterisk (*) in the diagram below; in the mutated sickle-cell βS allele this restriction site has been lost. What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an individual with sickle cell disease (have 2 βS alleles)? Probe 1 Probe 2 (a) 0.6kb 0.6kb and 1.2kb (b) 0.6kb and 1.8kb 0.6kb, 1.2kb and 1.8kb (c) 1.2kb 0.6kb (d) 1.8kb 1.8kb a. (a) b. (b) c. (c) d. (d)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
An Introduction to the Human Genome | HMX Genetics; Author: Harvard University;https://www.youtube.com/watch?v=jEJp7B6u_dY;License: Standard Youtube License