Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 16QP
Cloned Libraries
You are running a PCR to generate copies of a fragment of the cystic fibrosis (CF) gene. Beginning with two copies at the start, how much of an amplification of this fragment will be present after six cycles in the PCR machine?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In PCR amplification Why is it important to know the length of the sequence you amplify?
Make the PCR Cocktail
This table lists the ingredients, stock reagent concentrations, and concentrations in the PCR reaction.
Prepare a "PCR cocktail" to be added to your samples to achieve these concentrations. Make enough cocktail to run nine samples.
[Four student samples + three positive controls + one negative control + one extra.]
{Hint: Remember that the concentration in the reaction is not the same as the concentration in the cocktail!]
Component
Stock Concentration
Concentration in the PCR reaction
Volume per reaction
Volume to make cocktail
Sterile water
-
-
µl
µl
PCR buffer w/ MgCl2
10x
1x
µl
µl
Nucleotide mix
10 mM
0.2 mM
µl
µl
Primer 1 (Forward)
10 µM
1.0 µM
µl
µl
Primer 2 (Reverse)
10 µM
1.0 µM
µl
µl
Taq DNA polymerase
5 U/µl
1.0 U
µl
µl
DNA template (sample)
-
~1 ng
20 µl
µl
Total
-
-
40 µl
µl
Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had
indeed facilitated research in various areas of molecular biology and genetics. You would like
to amplify a particular gene fragment from the yeast genome using Polymerase Chain Reaction
(PCR). What are the THREE (3) main cycles in PCR? Discuss the processes at each PCR cycle
mentioned.
Chapter 13 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 13.5 - Do you think the way this issue was handled should...Ch. 13.5 - Prob. 2EGCh. 13.7 - If you were offered the chance to have the genome...Ch. 13.7 - Prob. 2EGCh. 13 - Improving the nutritional value of food has long...Ch. 13 - Improving the nutritional value of food has long...Ch. 13 - Prob. 3CSCh. 13 - What Are Clones? Cloning is a general term used...Ch. 13 - Prob. 2QPCh. 13 - Prob. 3QP
Ch. 13 - Prob. 4QPCh. 13 - Prob. 5QPCh. 13 - Prob. 6QPCh. 13 - Cloning Genes Is a Multistep Process The following...Ch. 13 - Prob. 8QPCh. 13 - Prob. 9QPCh. 13 - Cloning Genes Is a Multistep Process Which enzyme...Ch. 13 - Cloning Genes Is a Multistep Process In cloning...Ch. 13 - Prob. 12QPCh. 13 - Prob. 13QPCh. 13 - Prob. 14QPCh. 13 - Prob. 15QPCh. 13 - Cloned Libraries You are running a PCR to generate...Ch. 13 - Prob. 17QPCh. 13 - Prob. 18QPCh. 13 - Prob. 19QPCh. 13 - Analyzing Cloned Sequences A base change (A to T)...Ch. 13 - Prob. 21QPCh. 13 - Analyzing Cloned Sequences What kind of...Ch. 13 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- This is what the LAB FLOW would look like: CULTURE BACTERIA EXTRACT RNA RANDOM HEXAMER REVERSE TRANSCRIPTION OF RNA PCR OF lacZ GENE ELECTROPHORESIS If you wanted to prepare only one PCR reaction, how much of each reagent would you add to the PCR tube? What would be the final primer concentration if 0.5 μl of 10 μM primers were added to a PCR reaction with a final volume of 20 μl?arrow_forwardRunning a PCR Why is a Hotstart necessary and how is it achieved? Why are the three temperatures necessary for PCR? Explain the role of each. Why does the lid of the thermocycler need to be heated? Why did we conduct an amplification reaction with no DNA? When looking at your PCR results why do you only see one band? What size were each of your PCR products?arrow_forwardPCR errors during library amplification are one possible source of false positive results. If an error occurs in the first round of amplification, all the subsequent copies of that library fragment will also carry the variant, even though it is not present in the genome. However, reads from other library fragments spanning this same region will not have the variant, which means that identifying PCR copies, or clones, of library fragments during analysis can help to identify these types of errors. Based on what you know about PCR, which of the following statements would be true about the PCR clones in a sequencing library? A. PCR is subject to amplification bias, so reads derived from PCR clones will only map to regions that are not GC-rich. B. PCR is subject to amplification bias, so reads derived from PCR clones will only map to non-repetitive regions. C. PCR produces identical copies, so reads derived from PCR clones would map to the exact same location. D. PCR introduces many…arrow_forward
- A typical polymerase cycle reaction (PCR) program (Figure 3) followed as: HOLD 1 HOLD 3 HOLD 2 (30CYCLES) 95° C 94°C 72C 72° C 04:00 1:00 1:00 10:00 52.0° C 1:00 04° C 00 Figure 3 (i) Why is polymerase cycle reaction (PCR) repeated 30 times (Figure 3)? What are the differences between primers for PCR program, and primers for DNA replication process during S-phase? (ii) (iii) What are the FIVE (5) basic reagents used in PCR?arrow_forwardWhat is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment? What is the percent efficiency of the PCR experiment if the actual number of copies was 500,000,000? Show your calculationsarrow_forwardThe exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being amplified. Consider a 10-kbp DNA sequence in a genome of 1010 base pairs. What fraction of the genome is represented by this sequence; i.e., what is the fractional abundance of this sequence in this genome? Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forward
- You are working in a molecular biology laboratory and are having challenges with your PCR. You decide to double-check the PCR protocol programmed into the thermal cycler and discover that the annealing temperature was programmed to be 65 °C instead of 50 °C, as you had intended. What effects would this mistake have on the PCR reaction? Suggest potential solution(s).arrow_forwardAnalyze the PCR products in Fig. 1A by describing your observations and the PCR result. Your analysis should be in maximum of 5 sentences in bullet form. Include the following in your analysis: Observations: Are bands present? If yes, what the approximate size in bp of each band? Results: Was amplifying the target gene successful?arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forward
- The process of PCR essentially revolves around three phases. Briefly describe these phases and the events that occur in them. Take note the temperature on which these phases take place.arrow_forwardYou want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map included). After enzyme digestion your amplicon is 854 bp long. What length will the recombinant plasmid be after you have inserted your amplicon? Show a calculation.arrow_forwardWhat is the difference between PCR and real time PCR? and What happens during PCR? Write in detail.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License