Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 16TYU
Summary Introduction
To sketch: The figure to show the way in which reverse transcription is catalyzed by the enzyme reverse transcriptase and labeling of
Introduction: A gene is a set of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.
5'-GCAAGUCUUAAU-3'
Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do
not include the stop codon.
Example: ala-cys-glu
1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn
2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting
amino acid sequence?
3. What type of mutation occurred? Choose from same sense, missense and non-sense.
The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the
transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram.
Motivate your answers.
(i)
the template and the non-template strands;
(ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand;
(iii) the location of a possible promotor sequence;
(iv) the location of a possible Shine-Dalgarno sequence;
(v)
the specific area of activity of a RNA polymerase.
Consider this list (below) of steps involved in transcription. These steps are out of order.
TRANSCRIPTION:
1. mRNA travels through a nuclear pore and enters the cytoplasm
2. the mRNA polymerase attaches at the start of a specific gene
3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound
6. a complimentary mRNA is produced
What is the correct order of this transcription?
Chapter 13 Solutions
Biology (MindTap Course List)
Ch. 13.1 - Summarize the early evidence indicating that some...Ch. 13.1 - Describe how Beadle and Tatums experiments...Ch. 13.1 - Prob. 1CCh. 13.1 - How did the work of each of the following...Ch. 13.2 - Outline the flow of genetic information in cells,...Ch. 13.2 - Compare the structures of DNA and RNA.Ch. 13.2 - Explain why the genetic code is said to be...Ch. 13.2 - VISUALIZE Sketch a simple flow diagram that shows...Ch. 13.2 - Prob. 2CCh. 13.3 - Compare the processes of transcription and DNA...
Ch. 13.3 - Compare bacterial and eukaryotic mRNAs, and...Ch. 13.3 - In what ways are DNA polymerase and RNA polymerase...Ch. 13.3 - A certain template DNA strand has the following...Ch. 13.3 - What features do mature eukaryotic mRNA molecules...Ch. 13.4 - Identify the features of tRNA that are important...Ch. 13.4 - Explain how ribosomes function in polypeptide...Ch. 13.4 - Prob. 10LOCh. 13.4 - Prob. 11LOCh. 13.4 - What are ribosomes made of? Do ribosomes carry...Ch. 13.4 - What happens in each stage of polypeptide...Ch. 13.4 - A certain mRNA strand has the following nucleotide...Ch. 13.5 - Give examples of the different classes of...Ch. 13.5 - What are the main types of mutations?Ch. 13.5 - Prob. 2CCh. 13.6 - Briefly discuss RNA interference.Ch. 13.6 - Prob. 14LOCh. 13.6 - Prob. 15LOCh. 13.6 - Prob. 1CCh. 13.6 - Prob. 2CCh. 13.6 - Prob. 3CCh. 13 - Prob. 1TYUCh. 13 - What is the correct order of information flow in...Ch. 13 - During transcription, how many RNA nucleotide...Ch. 13 - The genetic code is defined as a series of...Ch. 13 - RNA differs from DNA in that the base...Ch. 13 - Prob. 6TYUCh. 13 - Which of the following is/are not found in a...Ch. 13 - Which of the following is/are typically removed...Ch. 13 - Prob. 9TYUCh. 13 - Suppose you mix the following components of...Ch. 13 - Prob. 11TYUCh. 13 - Prob. 12TYUCh. 13 - Compare and contrast the formation of mRNA in...Ch. 13 - Explain to a friend the experimental strategy that...Ch. 13 - Biologists hypothesize that transposons eventually...Ch. 13 - Prob. 16TYUCh. 13 - Prob. 17TYUCh. 13 - Prob. 18TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Based on the electron micrograph shown, which of the following statements is/are correct/true? Select all that apply. You may select mutiple options. DNA and mRNAs are marked by arrows. DNA mRNAs #3 Left Right 1 μm You cannot determine relative mRNA lengths from this image You cannot determine the direction of transcription from this image the longest mRNA is on the right side ✔Direction of transcription is left to right O Direction of transcription is right to left the 5' end of the mRNA marked #3 is at the bottom O the longest mRNA is on the left side the 5' end of the mRNA marked #3 is at the top You cannot determine the 5' or 3' mRNA ends from this imagearrow_forwardGiven the sequence of the DNA template GTCATG. What would be the mRNA.arrow_forwardIdentify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.…arrow_forward
- Consult the DNA below. Only one strand is shown (the complementary strand is not shown). What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................arrow_forwardThis diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the transcription start site. The direction of transcription is also indicated. In which box would you find a 5’TATAA \3’ promoter sequence that would be used for initiating transcription at the start site shown? a) Box A b) Box B c) Box C d) Box Darrow_forwardBriefly describe transcription?with example.arrow_forward
- The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forwarda) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forwardConsider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyrarrow_forward
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardAssume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter • Draw a box where you would expect to find the TATA box Draw a third line below the model representing the RNA transcript (label the ends!) Label one of the DNA strands as the template strand 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 3' 5' +1 5' 3'arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license