Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 5FIB
Summary Introduction
Introduction: Deoxyribonucleic acids (DNA) are the genetic material of most of the organisms that contain coded genetic material in the form of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
During DNA Replication, _____________ is synthesized in a series of short pieces called _______________
Each new double helix will contain ___________ strand of DNA from the parent strand and ____________ strand of newly created DNA.
In DNA replication the enzyme called________ lats down the initial short piece of template RNA.
Chapter 12 Solutions
Biology
Ch. 12.1 - Which do you think would be more difficult to...Ch. 12.1 - If viral genetic material had the same structure...Ch. 12.1 - Prob. 1CYLCh. 12.1 - Prob. 2CYLCh. 12.2 - Muscles, Mutations, and Myostatin The sequence of...Ch. 12.2 - Prob. 1CYLCh. 12.3 - describe the process of DNA replication, including...Ch. 12.3 - explain why DNA replication is called...Ch. 12.3 - Muscles, Mutations, and Myostatin "Double-muscled"...Ch. 12.4 - How Much Genes Influence Athletic Prowess?
Ch. 12.4 - explain what mutations are and how they occur?Ch. 12.4 - explain why mutations are rare?Ch. 12.4 - describe the different types of mutations?Ch. 12.4 - Prob. 1TCCh. 12 - If a parental DNA strand has the base sequence...Ch. 12 - Prob. 2MCCh. 12 - Prob. 3MCCh. 12 - The rungs of the DNA double helix consist of a....Ch. 12 - Prob. 5MCCh. 12 - Prob. 1FIBCh. 12 - Prob. 2FIBCh. 12 - Prob. 3FIBCh. 12 - Prob. 4FIBCh. 12 - Prob. 5FIBCh. 12 - Prob. 6FIBCh. 12 - Prob. 1RQCh. 12 - Prob. 2RQCh. 12 - Describe the structure of DNA. Where are the...Ch. 12 - Prob. 4RQCh. 12 - Describe the process of DNA replication.Ch. 12 - How do mutations occur? Describe the principal...Ch. 12 - Prob. 1ACCh. 12 - Genetic information is encoded in the sequence of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The fragment of DNA in replication are called______fragments.arrow_forwardIf the sequence of one strand on DNA is… CTA GCT CCAits complementary strand will be… _____________arrow_forwardDNA replication begins with the pre-replication complex binding to _____________ and beginning to separate the two strands of the helix. the promoter the 3’ end of the DNA the origin the start codonarrow_forward
- A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, write the sequence of the newly synthesized strand in the direction from left to right in which it will be synthesized.arrow_forwardThe enzyme required to open up the double stranded DNA during replication and form the replication fork (two single stranded DNA) is called a 신arrow_forwardDuring DNA replication, the enzyme called _______ unwinds the DNA double helix structure, separating the two strands of DNA apart. These two DNA strands serve as templates for synthesis of new DNA. The two strands are held apart by ______ , stabilizing the open "bubble" configuration.arrow_forward
- A large number of nucleotide base pairs along a DNA molecule is a specific region called a _____arrow_forwardYou see that a piece of DNA is being copied. But you cannot tell if this an example of DNA replication or RNA transcription. Describe three ways that you can tell the two processes apart.arrow_forwardWhy does DNA have a leading strand and a lagging strand during replication?Select the correct row below that fills in the following blanks to answer the question above.___1st___ has to attach the new free-floating nucleotides to the ___2nd___ of the newly formed strand. The two strands of a DNA molecule are antiparallel, so in order for the lagging strand to be formed in the same direction, it has to be done in Okazaki fragments going in a ___3rd___ direction. Select one: a. 1st 2nd 3rd DNA polymerase 3' end 5' to 3' b. 1st 2nd 3rd DNA polymerase 5' end 3' to 5' c. 1st 2nd 3rd DNA ligase 3' end 5' to 3' d. 1st 2nd 3rd DNA helicase 5' end 3' to 5'arrow_forward
- The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.arrow_forwardSometimes mistakes are made during DNA replication. If uncorrected, these mistakes are called _________. When a single nucleotide is changed, this is called a(n)_________.arrow_forwardWhat is the smallest unit of DNA is called ________?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY