Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 2PDQ
CONCEPT QUESTION Review the Chapter Concepts list on p. 263. These all relate to how DNA is organized in viral, bacterial, and eukaryote chromosomes. Write a short essay that contrasts the major differences between the organization of DNA in viruses and bacteria versus eukaryotes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
11:29
Protein 6-10092015113530.pdf
https:api.schoology.comv1attachment169963838...
Name
Class
Date
2. How are enzymes involved in this process?
3.
hаppens
anzips"?
4. Why is it important that exact copies of DNA be made?
5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the
corresponding sequence on the other strand?
E Concept Mapping
The construction of and theory behind concept mapping are discussed on
pages vil-ix in the front of this Study Guide. Read those pages carefully. Then
consider the concepts presented in Section 7-1 and how you would organize
them into a concept i
page 74. Notice that the concept map has been started for you. Add the key
Now look at the concept map for Chapter 7 on
concepts you
are important
Secti
When you have
finished the chapter, you will have a completed concept map.
69
1 of 1
Given the following Wild Type and Mutated DNA sequences:
1.) Identify where the base pair change occurs ( what letter changed?)
2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences.
3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.
Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5'
Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
a) Explain how the molecular mechanism of DNA polymerase enhances DNA replication.
b) Discuss the characteristic of DNA polymerase 1,
Nick translation
Proofreading
Chapter 12 Solutions
Concepts of Genetics (12th Edition)
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Name an important difference in the replication of circular DNA versus linear double-stranded DNA.arrow_forwardIn bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?arrow_forward35. M Heinz Shuster collected the following data on the base composition Move ANALYSIS ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A T U Ribgrass 29.3 25.8 18.0 0.0 27.0 mosaic virus Leibniz Institute for Age Research, Fritz Lipmann-Institute. Ribgrass mosaic virus.arrow_forward
- 10:14 Protein 5-10092015113503.pdf https:api.schoology.comv1attachment169963838... Name Class Date RNA (pages 146-148) | SECTION REVIEW In this section you were introduced to the molecule that helps put the information in DNA to use: ribonucleic acid, or RNA. ANA Iis a nucleic acid that carries information from DNA to the ribosomes, the organelles in which proteins are made. RNA also carries out the process by which proteins are assem- bled from amino acids. RNA is quite similar to DNA in structure. However, there are some important differ- ences. RNA is single-stranded; DNA is dou- ble-stranded. RNA contains the sugar ribose; DNA contains deoxyribose. And RNA has the nitrogenous base uracil; DNA has thymine. In this section you also learned about the process of transcription. Transcription is t process in which part of a DNA molecule is used as a template for the synthesis of a com- plementary strand of RNA. This process is mediated by an enzyme called RNA poly- merase. The strand of…arrow_forwardIn a clinical context, a scientist is working with a viral DNA which is about 24000bps long. There are two known variants of the virus that share almost the same DNA but for a final fragment; with reference to Figure Q2b, the regions A and B are conserved in both variants, while the region C differs and is either 320bps (variant 1) or 380bps (variant 2). The scientist wants to set up a procedure to identify the variant they are dealing with. Viral dsDNA (i) (ii) (iii) Stable region (A) Variable region (C) Figure Q2b Known sequence (B) 5-GACCTCAATGTCCAGCGGTACGCTCATAAA-3' 3'-CTGGAGTTACAGGTCGCCATGCGAGTATTT-5' The scientists want to design a primer to amplify the variable region and to do so, they sequence a small fragment (sequence B) the conserved region close to the variable region C. Why is the scientist targeting a region outside of the fragment of interest? [3] The sequence of the fragment B is reported in Figure Q2b. Suggest a primer that can efficiently target this region and…arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'arrow_forwardHeinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A G C T U Ribgrass mosaic virus 29.3 25.8 18.0 0.0 27.0arrow_forward22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…arrow_forward
- This is a three part question: Figure B in Box 4.1 illustrates the results of the Meselson-Stahl experiment after a single cycle of replication in 14N. (a) Explain the results they observed after two rounds of replication in 14N medium. (b) Draw out the expected results if a third round of replication were allowed in 14N medium. (c) Two other models for template-directed replication were considered as alternatives to semi-conservative replication. One of these was conservative replication, in which the parental strands were unpaired, replicated, then reannealed such that the parental strands stayed together and the newly synthesized strands were together. The second model was dispersive replication, in which one strand was used as the template for polymerization, then the polymerase switched to using the other strand as the template, and subsequently switched back and forth between the two strands until bother were fully replicated. Each of these models is ruled out by one of your…arrow_forwardDescribe the “end-replication problem” in eukaryotes. How is itresolved?arrow_forwardResearchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly. (a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene? (b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene? (c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY