Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 24ESP
Following is a diagram of the general structure of the bacteriophage λ chromosome. Speculate on the mechanism by which it forms a closed ring upon infection of the host cell.
5′ GGGCGGCGACCT—double-stranded region—3′
3′—double-stranded region—CCCGCCGCTGGA 5′
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A small section of Saccharomyces cerevisiae gene has the amino acid sequence valine, histidine, cysteine, and lysine.
A mutation in the above section of the amino acid sequence resulted in the substitution of amino acid histidine with amino acid glutamine.
The mutation in the antisense strand DNA of Saccharomyces cerevisiae gene described above involves
a. the substitution of thymine base from GTG
b. the deletion of second cytosine base from CAC
c. the deletion of second guanine base from GTG
d. the substitution of second cytosine base from CAC
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends.
DNA:
5'-ATAGGGCATGT-3'
3'-TATCCCGTACA-5' <--- template strand
Group of answer choices
5'-ATAGGGCATGT-3'
3'-UAUCCCGUACA-5'
5'-AUAGGGCAUGU-3'
3'-TATCCCGTACA-5'
Chapter 12 Solutions
Concepts of Genetics (12th Edition)
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forwardDuring the process of protein synthesis on a ribosome, when the large ribosomal subunit covalently attaches an amino acid to a growing polypeptide, what is the name of this newly formed covalent bond? the phosphodiester bond the peptide bond the aminoacyl bond the ether bond the glycosidic bond The ability of F+ cells, or Hfr cells, to transfer plasmid DNA to an F- cell is properly called: transversion transformation conjugation transduction transitionarrow_forward
- Explain, with the aid of a hand drawn diagram, the life cycle of bacteriophage T4.arrow_forwardIf the recipient cell did not already have a lys− gene, could the lys+ DNA become incorporated into the bacterial chromosome? Explain.arrow_forwardGiven the diagram of the replication fork below, indicate the chemical group (5'-P, 3'-P, 3'-OH or 5'-OH) most likely to be found at the sites indicated below by the dots labeled A, B, and C.arrow_forward
- Figure 1 is a photography obtained after spreading the replicating Escherichia coli chromosome and its observation by transmission electron microscopy. An interpretation scheme of the observed structure is shown in the upper right part of the photo. Figure 1: Photography of a replicating Escherichia coli chromosome observed by transmission electron microscopy. what is occurring at the positions C indicated by black arrows? what is the name of the main actor located at positions C?arrow_forwardA small section of Saccharomyces cerevisiae gene has the amino acid sequence valine, histidine, cysteine, and lysine. A mutation in the above section of the amino acid sequence resulted in the substitution of amino acid lysine with amino acid asparagine. The mutation in the antisense strand DNA of Saccharomyces cerevisiae gene described above involves Select one: a. the substitution of second adenine base from AAG b. the substitution of second thymine base from TTC c. the substitution of guanine base from AAG d. the substitution of cytosine base from TTCarrow_forwardThe beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACCATTATАССССТАСGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?arrow_forward
- Transcribe the following strand of DNA into RNA: 5'-AAGTTCGA-3'arrow_forward#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:arrow_forwardThe beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACСАТТАТАССССТАСGTGATAG...5" promoter a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY