Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 14PDQ
How many base pairs are in a molecule of phage T2 DNA 52 μm long?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How many base pairs are in a molecule of phage T2 DNA that is52 μm long?
What is the advantage for bacteria to have a circular DNA chromosome when eukaryotes have linear DNA chromosomes?
A Plasmid is 3.6kb large. It is digested with an enzyme that has restriction sites at 1,152 and 2,954. How many fragments do we have and what are their sizes?
Chapter 12 Solutions
Concepts of Genetics (12th Edition)
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a) A plasmid DNA in bacteria has a length of 14,000 bp and an Lk of 1300. Calculate the superhelical density o for this plasmid. Show your work for partial credit, round to one digit after the decimal point. b) You use a Type II topoisomerase to change the linking number of this plasmid to 1310. How many turnovers must the topoisomerase perform? Is this resulting plasmid underwound or overwound?arrow_forwardWhat is B-form DNA?arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
- What is true regarding the following cross between bacterial strains: F’ x F-? As the donor, F' will donate only the F plasmid to F- As the donor, F- will donate the F plasmid only to F' As the donor, F- will donate the F plasmid and a portion of the bacterial chromosome to F' As the donor, F' will donate the F plasmid and a portion of the bacterial chromosome to F-arrow_forwardIn the Hershey Chase experiment, why was the localization of radio-labeled phage of macromolecules in the cytoplasm the reason that the genetic material identity was proved.arrow_forwardWhat color colonies will cells that contain a recombinant plasmid form?arrow_forward
- In the gel electrophoresis: the mutant would just run the same as the open circle DNA if it simply weren't able to close its circle. The mutant contains heavier than the single-stranded DNA because what kind of structure is it forming during replication? Wild-type phage DNA does not ever form a double-strand. What happens under denaturing conditions to that structure that helps explain that lane's smudge?In the sucrose centrifuging: what data from the gel electrophoresis support the conclusion?In the electrophoresis/Southern blot: which end of the DNA is the 1100 bp fragment, which end does the kinase ONLY work on?arrow_forwardDescribe the “end-replication problem” in eukaryotes. How is itresolved?arrow_forwardIn bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license