Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11.4, Problem 4CC
Summary Introduction
To determine: The requirement that telomerase uses as a template to make the DNA repeat sequence.
Introduction: Telomerase is an enzyme that was discovered by Elizabeth Blackburn. It is an enzyme involved in the production of telomere in the human body. Telomeres are the protecting units of chromosomes in eukaryotes. They are repeating DNA sequences and contain a 3ʹoverhang at its 3ʹterminal. It has been discovered that protein and RNA are important components of a telomerase enzyme.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Macmillan Learning
What factors promote the fidelity of replication during synthesis of the leading strand of DNA?
removal of the RNA primers between Okazaki fragments by DNA polymerase I
breaks that occur in the leading strand are repaired by DNA ligase
prevention of mismatched nucleotides at the replication fork by topoisomerase
removal of wrongly inserted nucleotides by the 3'-exonuclease activity of DNA polymerase III
Watson-Crick base pairing between the template and leading strand
Incorrect
Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene.
a) nuclease, DNA polymerase, RNA primase
b) helicase, DNA polymerase, DNA ligase
c) DNA ligase, nuclease, helicase
d) nuclease, DNA polymerase, DNA ligase
primase
22.
The enzyme
DNA replication. Why are the RNA primers necessary for DNA synthesis (
one statement)? Are the same number of primers required for the leading
and lagging strand (no more than two statements)?
synthesizes the RNA primers required for
Chapter 11 Solutions
Biology
Ch. 11.1 - Prob. 1CSCh. 11.1 - Prob. 1EQCh. 11.1 - Prob. 2EQCh. 11.1 - CoreSKILL In the experiment of Avery, MacLeod,...Ch. 11.2 - Prob. 1CCCh. 11.2 - Prob. 2CCCh. 11.2 - Core Skill: Modeling The goal of this modeling...Ch. 11.2 - Prob. 2CSCh. 11.3 - If this experiment was conducted for four rounds...Ch. 11.4 - Molecular Mechanism of DNA Replication Concept...
Ch. 11.4 - Prob. 2CCCh. 11.4 - Prob. 3CCCh. 11.4 - Prob. 4CCCh. 11.5 - Prob. 1CCCh. 11.5 - Prob. 1CSCh. 11 - Why did researchers initially believe that the...Ch. 11 - Prob. 2TYCh. 11 - Which of the following equations is accurate...Ch. 11 - Prob. 4TYCh. 11 - Which of the following statements about the...Ch. 11 - Meselson and Stahl were able to demonstrate...Ch. 11 - During replication of a DNA molecule, the daughter...Ch. 11 - Prob. 8TYCh. 11 - A nucleosome is a. a dark-staining body composed...Ch. 11 - The conversion of euchromatin into heterochromatin...Ch. 11 - What are the four key criteria that the genetic...Ch. 11 - A double-stranded DNA molecule contains 560...Ch. 11 - Prob. 3CQCh. 11 - Prob. 1COQCh. 11 - CoreSKILL How might you provide evidence that DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?arrow_forwardVISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the synthesis ofa leading strand? In the overview box in Figure 16.17,point out where DNA pol I would normally function onthe top leading strand.arrow_forwardReplication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?arrow_forward
- Yeast artificial chromosome how the synthesised?arrow_forward4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragmentsarrow_forwardPractice: DNA Structure and Replication 1. Label each part of the model to the right. Include specific nitrogen base pairs in your labeling. 2. What molecule is it? 3. What is its purpose? 4. Where can it be found in a prokaryotic cell? 5. Where can it be found in a eukaryotic cell? 6. It gets copied during a process called replication. When does this happen? 7. What is the result of DNA replication? 8. Why is DNA replication necessary? 10. What would the chromosome to the right look like after DNA replication? 11. What would the chromosome to the right be called after DNA replication? 9. Why is DNA replication said to be semi-conservative? Draw a picture to support your answer. TAACCGAGTTCAGA b. TTAACCGAGTTCAGA Genetics Unit Sol Sol Dal 12. Replicate the following four DNA strands using what you know about complementary base pairs. TACOTCCAGATITT a. AATACGTCCAGATTTT c. CCCGCGGAATATACA O book It's Not Rocket Science 2016 d. AGGGCTACTTCAGAC J 7arrow_forward
- . Indicate the role of each of the following in DNA replication: (a) topoisomerase, (b) helicase, (c) primase,and (d) ligase.arrow_forwardSensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP [1]arrow_forwardExplain the molecular mechanism of DNA polymerization by DNA polymerase and explain why DNA polymerase 3 and not dna polymerase 1 is responsible for replicating the bacterial genome.arrow_forward
- Compare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features: (a) activated precursors,(b) direction of chain elongation, (c) conservation of the template, and(d) need for a primer.arrow_forwardCompare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substratesarrow_forwardAKS 5b: Which statement is correct regarding the semiconservative nature of DNA? * The semiconservative nature of DNA allows for genetic stability in somatic gene production MRNA operates as a template to allow DNA to replicate itself using ribosomes The structure of the phosphate group on the DNA molecule direct the correct nucleotides into place during replication Nucleotides in each original strand serve as a template for the new strand to be made AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * * AA AA AA AA АВ ВА AA BB AA AA АВ АС Figure A Figure B Figure C Figure Darrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY