Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 28P
In an Ames test using
a. What is the reason for the different experimental results described?
b. Is the test compound still considered to be a potential mutagen? Explain why or why not.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
After mutagenesis of wild type Vibrio fisheri, you isolate two different mutant strains (A and B) that, unlike the wild type cells, fail to luminesce when grown to high density in a flask with appropriate medium. Curiously, however, when you inoculate both mutant strains in the same flask, you observe that the mixed (A+B) culture begins to emit light after growing dense.
a) What gene/functions are likely affected in each of the two mutants?
b) How does this explain their phenotypes?
Mutation analysis of GCK gene in patients with diabetes revealed a c.114 T->A (shown in
bold and underlined) substitution in heterozygote state. In order to check the mutation in
healthy individuals, restriction enzyme analysis will be used.
a) which enzyme can we use to differentiate wild type and mutant sequence? Please
indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme.
Use table 1 shown below.
b)
ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTG
СTGAGGCCACTCCTGGTCACCATGACAАССАCAGGCCCTCTТСAGTATCACAGTAAGCCCTGGCAGG
AGAATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAG
CAGGCTAGGATGTGA
Figure 1. GCK gene sequence. Length of the fragment is 213bp.
Table1. The restriction enzymes and their recognition sequences.
Bestriction enzyme
Recognition sequence
Nari
GG/CGCC
Ddel
C/TOAG
Hae II
DGCGC/n
Hpal
cc/GG
Alul
AG/CT
Smal
ccc/GGG
Mbol
/GATC
Mae II
IGTDAC
Bsp 1286 I
GNGCn/c
Hind II
A/AGCTT
ECOR I
G/AATTC
D: any Ducleotide
1:…
A research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.
Chapter 11 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 11 - 11.1 Identify two general ways chemical mutagens...Ch. 11 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 11 - 11.3 What is the difference between a transition...Ch. 11 - What is the difference between a synonymous...Ch. 11 - 11.5 UV irradiation causes damage to bacterial...Ch. 11 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 11 - Researchers interested in studying mutation and...Ch. 11 - The effect of base - pair substitution mutations...Ch. 11 - Describe the purpose of the Ames test. How are...Ch. 11 - 11.10 In numerous population studies of...
Ch. 11 - 11.11 Two different mutations are identified in a...Ch. 11 - What is the phenotype effect of inserting a Ds...Ch. 11 - 11.13 Answer the following questions concerning...Ch. 11 - Several types of mutation are identified and...Ch. 11 - 11.15 A sample of the bacterium is exposed to...Ch. 11 - 11.16 A strain of is identified as having a null...Ch. 11 - Describe the difference between DNA transposons...Ch. 11 - 11.18 How are flanking direct repeat sequences...Ch. 11 - 11.19 Using the adeninethymine base pair in this...Ch. 11 - The partial amino acid sequence of a wild-type...Ch. 11 - Prob. 21PCh. 11 - 11.22 Many human genes are known to have homologs...Ch. 11 - The fluctuation test performed by Luria and...Ch. 11 - In this chapter, three features of genes or of DNA...Ch. 11 - Briefly compare the production of DNA double -...Ch. 11 - During mismatch repair, why is it necessary to...Ch. 11 - 11.27 Following the spill of a mixture of...Ch. 11 - 11.28 In an Ames test using Salmonella bacteria a...Ch. 11 - A wild - type culture of haploid yeast is exposed...Ch. 11 - A fragment of a wild - type polypeptide is...Ch. 11 - Prob. 31PCh. 11 - Alkaptonuria is a human autosomal recessive...Ch. 11 - 11.33 In an experiment employing the methods of...Ch. 11 - Using your knowledge of DNA repair pathways choose...Ch. 11 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 11 - A geneticist searching for mutations uses the...Ch. 11 - 11.37 In a mousebreeding experiment a new mutation...Ch. 11 - 11.38 Considering the Dumbo mutation in a Problem,...Ch. 11 - 11.39 Thinking back to the discussion of...Ch. 11 - 11.40 Common baker’s yeast () is normally grown at...Ch. 11 - 11.41 The two gels illustrated below contain...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Cancer cells must be able to proliferate indefinitely. Therefore, many inappropriately express telomerase. a. What is the function of telomerase? b. Why does telomerase enable cells to proliferate indefinitely?arrow_forwarda. Why doesn't Dpnl digest the mutagenized DNA? b.What is the approximate size, in base pairs, of the pQE.1-CRYGD plasmid?arrow_forwardIn the transformation experiment by Griffith, two strains of an organism was injected into a mouse model. One, he labelled S was a heat-killed but pathogenic strain while the other, R was a non- virulent or non-pathogenic strain. Within 48 hours, the mouse died and only the S strain was obtained from the dead mouse. What conclusions can you derived from this experiment? A. Some of the pathogenic S strains survived, proliferated and subsequently overpowered the R strain. B. The R strains mutated and were converted to a pathogenic S strain. C. The R strains assimilated the DNA from the S strain and were transformed into the S strain. D. The R strain DNA hybridized with the S strain DNA such that the daughter DNA of the new generation of R all contained the S DNA. E. All of these conclusions are possible.arrow_forward
- Streptococcus pneumoniae cells of genotype str s mtl - are transformed by donor DNA of genotype strr mtl+ and (in a separate experiment) by a mixture of two DNAs with genotypes strr mtl - and str s mtl+. The accompanying table shows the results.a. What does the first row of the table tell you? Why? b. What does the second row of the table tell you? Why?arrow_forwardYou have two mutants of pQE. 1-CRYGD. One is 66 ng/uL and the other is 337 ng/uL. You need to add 1 ng to your competent NEB Express Iq cells. A. Can you accurately pipet the plasmid for each? Why or why not? B. How could you dilute the plasmid to obtain 50 uL of 0.5 ng/uL? C.How much of the new 0.5 ng/uL sample would you need to pipette for 1 ngarrow_forwardAfter performing analysis of whole genome sequencing from a candidate that grew on SC-H in the initial screen, you are unable to identify a causative mutation. Which of the following options is a likely explanation for why this mutant passed the initial screen? Select all that apply. A. The mutation is a truncation mutation and Illumina sequencing only provides information for missense mutations. B. One of the missense mutations you analyzed is actually causative, but the factor has not been previously linked to transcription. C. The causative mutation lies in a sequence coverage gap. D. The mutation is in a hypothetical protein and uncategorized genes cannot be sequenced by Illumina technology.arrow_forward
- Compared to the normal A allele, the disease-causing allele in sickle cell anemia (S allele) is missing an MstII restriction site. On a Southern blot of genomic DNA cut with MstII and hybridized with the probe shown on the diagram below, a person with sickle anemia, carrying two S alleles, will show Choose an answer below: a single band at 1.1 kb. a single band at 1.3 kb. a single band at 0.2 kb. one band at 0.2 and one at 1.3 kb. one band at 1.1 and one at 1.3 kb.arrow_forwardTransposon mutagenesis was used to generate a library of mutants within the Salmonella genome. You are trying to identify a colony with the transposon inserted in the pathogenic related gene SPI-1 using PCR. Forward and reverse primers are generated that flank either side of the gene and yield a wild type product that is 900 bases in length. Which of the colonies sampled in the gel would you expect to contain the SPI-1 gene with transposon insertion? 3,000 2,000 1,000 700 500 300 100 Ladder Colony A Colony B Colony C Colony D Colony E none colonies A&C colonies B&E O colonies A, C, &D colonies B, D, &E -arrow_forwardExplain in detail the AMES test which is used to test for the mutagenic potential of different compounds. Include an explanation of the AMES tester strains and how they work, why the liver is essential to this test and specifically why the control plate is necessary.arrow_forward
- The following table lists 4 bacterial strains that are partial diploids for lac operon genes. Given the activity of beta-galactosidase measured for each strain in the absence (-lac) or presence (+lac) of lactose, complete the table by choosing the appropriate symbol (+, -, C, S) to indicate the allele of the gene or site missing from the table (blue numbers). strain A BC 5 C D 7 chromosome I O 1 2 4 1 [Select] 9 3 [Select] [Select] [Select] 9 [Select] + + Z + + 6 + I +5 + 10 plasmid O 3 + 7 C Z + 8 8 2 [Select] 4 [Select] 6 [Select] B-gal act. -lac +lac 0.002 0.003 0.002 0.058 0.063 0.121 0.059 0.062 Select] 1 ✔ [ Select] + is C Sarrow_forwardA recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?arrow_forwardYou can carry out matings between an Hfr and F strain by mixing the two cell types in a small patch on a plate and then replica plating to selective medium. This methodology was used to screen hundreds of different cells for a recombination-deficient recA - mutant. Why is this an assay for RecA function? Would you be screening for a recA mutation in the F or Hfr strain using this protocol? Explain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY