Percentage of cells transformed into Transforming DNA str" mtl- str* mtl+ str" mtl+ str" mtl+ str" mtl- + str® mtl+ 4.3 0.40 0.17 2.8 0.85 0.0066
Q: What are the identities and functions of the components of the Bradford reagent in protein content d...
A: Different quantitative assays for the proteins are as follows: Biuret method Lowry's method Bradfor...
Q: 10. Given a DNA strand with nucleotide sequence 3' CCGTTACCGC 5', how many hydrogen bonds are formed...
A: Biomolecules are the molecules that participate in biochemical reactions. These are essential for su...
Q: What are intrinsically disordered proteins ? What are their features in terms of amino acid composi...
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide b...
Q: Why is BSA used as a standard for protein content determination? Can other proteins be used instead?
A: Bovine Serum Albumin is a protein which is derived from cows. It consists of 583 amino acids, bound ...
Q: Essay 2 Summary Response A X Xunw w du/courses/1118169/quizzes/3741087/take Question 7 Match the phr...
A: Match the phrase with the correct cell respiration substance. 10. Electron transport system...a. y...
Q: 10. Fatty acids containing double bonds are found in ________. a. polysaccharides. b. proteins. c. s...
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If y...
Q: How many microliters of the 500mM colchicine is required for making 1.5mL cell culture with 2mM colc...
A: Volume of cell culture = 1.5 ml = 1500 microL(V2) (1 ml = 1000 microL) Desired colchicine concentrat...
Q: Explain the mechanism by which statins lower “bad” cholesterol.
A: Lipoprotein can be defined as a biomolecule that is made up of fat droplets encircled by a phospholi...
Q: The monosaccharide shown below is the anomer. CH2OH CH2OH Но OH alpha- beta- O D- OL-
A: An anomer can be defined as the isomeric forms of monosaccharides that differ onlyin their configura...
Q: 16. What decides and allows amino acid residues are phosphorylated or dephosphorylated? 17. åre proc...
A: Phosphorylation of amino acids in the protein molecules plays an important role in signaling pathway...
Q: Please help me in detail. for molecular Mechanism of ATP versus GTP selectivity of adenylate kinase,...
A: Enzyme substrate selectivity is required for precise control of metabolic pathways. In cases where c...
Q: Below are structures of several steroid hormones derived from cholesterol. Circle the steroid nucleu...
A: Steroids are biological compounds which have four rings with specific molecular configuration. Stero...
Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to th...
A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary non-codi...
Q: . The optimal conditions for salivary lysozyme (hydrolyzing glycoproteins of bacterial wall) are 37 ...
A: Lysozyme is a naturally occuring enzyme found in bodily secretion such as- tears,saliva and milk. L...
Q: 1. The diagram shows a structure of a lipid molecule. What is the name of this type of lipid? b. How...
A: The lipid molecule consists of 3 fatty acids combined to the glycerol molecule through the formation...
Q: 1.) A sample contains 0.003 mg of NaOH. How many micrograms (μg) is this? 2.) An experiment was p...
A: Given Values: 1) Amount of NaOH in a sample = 0.003 mg 2) Molarity of Urea = 0.2 M Volume of urea = ...
Q: Who is the father of biochemistry?
A: Biochemistry means the study of biomolecules presents inside biological organisms. It can also be de...
Q: What do mutations in the cytoplasmic domain of the LDL receptor that cause familial hypercholesterol...
A: Familial hypercholesterolemia is a genetic disease that runs in families. It raises LDL (bad) choles...
Q: Why might it be necessary to include the 50 mL cultures in order to express protein? This question ...
A: Hi, First I would like to thank for submitting the question. The question has one error as the word ...
Q: 2. The diagram below shows the chemical structure of a lipid molecule. A В a. Is it a sphingophospho...
A: As you have asked multiple sub part questions we are supposed to answer only first 3 subparts.if you...
Q: What is protein and its important parts?
A: A biomolecule, sometimes known as a biological molecule, is any of the various compounds created by ...
Q: What is Intron retention type of alternativesplicing ?
A: A portion in mRNA that codes for protein is termed as exon. The non-coding region is termed as intro...
Q: Are all the proteins separated properly using isoelectric focusing? Why or why not?
A: The pH at which average charge on a protein is zero is termed as its isoelectric point and is design...
Q: 3. Below is the structure of a complex fatty acid that can be completely oxidized by the beta-oxidat...
A: Beta oxidation of fatty acid is catabolic process by which it converted to acetyl-CoA and Propionyl-...
Q: What is the definition of metabolism and what are the differences of catabolism from anabolism?
A: Glucose is the main substrate for carrying out cellular metabolism in the body, which is derived f...
Q: Which of the following is FALSE about Insulin?
A: The effects of insulin on bodily cells were inhibited in type 2 diabetes. As a result, glucose is un...
Q: Answer g-j
A: Isomaltose is a disaccharide composed of α-D glucose molecules joined together through α (1-6) glyco...
Q: Identify the principles of the lypophilization process and list down the precautions and limitations...
A: Lyophilization is a messy freeze-drying process that eliminates water from a product after it has be...
Q: Explain why oils become rancid. Provide short and concise answer with relevant examples.
A: Fats and oils are made up of triglycerides, which are esters made up of three fatty acid units bound...
Q: Assume you have an SAR of 0.206 for sample 1; 0.271 for sample 2; and 0.606 for sample 3, what does ...
A: The SAR values indicates that:
Q: Find the Gibbs free energy of mixing when 2 moles of ethanol is mixed with 5 moles of water at a tem...
A: Given; n1= no. of moles of ethanol= 2 mol n2= no. of moles of ethanol= 5 mol T=27oC =273+27=300K ...
Q: Why polymerization occurs ?
A: Polymerization is a chemical reaction in which a large number of monomer molecules combine to produc...
Q: In regards to the protein structure, explain what is meant by “tertiary structure.” What are the mai...
A: There are four levels of protein structure are important to attain the final 3- dimensional folded s...
Q: explain whether lactase enzyme is secreted as a zymogen requiring activation or not. If it is, pleas...
A: Lactase enzyme is an beta galactosidase which hydrolyses lactose to glucose and galactose. A zymogen...
Q: 4. a. Give the full names of the amino acids in this peptide. H3 N -CH-C-N-CH-C-N-CH- C ČH3 н Cнон н...
A: The pKa values of amino acid side chains that constitute a protein play an important role in determi...
Q: 4. Which of the following best describe the physical properties of fatty acids? a. All physical prop...
A: The backbone of triacylglycerols is constituted of a glycerol moiety in which all the three hydroxyl...
Q: 4. On a single-stranded DNA, the basic units are linked to one another by. A. Disulfide linkages B. ...
A: DNA or deoxyribonucleic acid is a type of biomolecule known as nucleic acid. The important component...
Q: During cell couting, when the data are plotted in an ordinary graph or on a cross-section paper, why...
A: For experiments involving growth of cells whether bacterial or eukaryotic the results of a growth ex...
Q: How did your soap compare to the commercially prepared soap?
A: If we wash oily/ greasy hands with soap then only oil/grease gets removed. In the sam...
Q: TEST COLOR +/- Violet ring Orange solution Reddish precipitate Biuret Xanthoproteic Millon Hopkin's ...
A: The different colour reactions tells about either the presence or absence of proteins and amino acid...
Q: (a) Propose a biosynthetic pathway to the secondary metabolite, B. OH O H. HO Metabolite B
A: The given metabolite structure is derivative of Salicylaldehyde derivative and synthesized by plant ...
Q: Evaluating: If a DNA strand reads AATGCTCCAGT, what would the complementary strand read: * O GGCAATC...
A:
Q: In order to optimize acetylcholinesterase inhibition, a set of benzylamine derivatives were studied,...
A: The given relationship [log(1/C) = -0.187π + 0.57σ + 3.893] represent Hansch QSAR analysis model. QS...
Q: A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacteri...
A: Meselson-Stahl experiment demonstrated that DNA replication takes place semi-conservatively which me...
Q: Given: One way to think about the hexokinase is that it couples the hydrolysis of ATP (AG° - -30.5 k...
A: Hexokinase: Hexokinase phosphorylate Glucose to Glucose-6-PO4 by utilizing one molecule of ATP. Here...
Q: Which of the following is the result of the hydrolysis of 5'-CTAGTTC-3' at the a side? ...
A: Nucleic acids are composed of nucleotides. Nucleotides are composed of a phosphate group, a pentose ...
Q: Using the chart below, can you produce a two-step procedure that demonstrates protein purification i...
A: Proteins are polymers of amino acids linked by peptide or amide bonds. Charge on the protein depends...
Q: Predict or describe the absorbance or enzyme activity at: pH = 2 pH = 14 Temperature = 25°C Tempera...
A: Introduction - The study of reaction rates and how they change in response to changes in experiment...
Q: Evaluating: Evaluate the following statements and determine which of them is FALSE about “agarose" *...
A:
Q: What were some of the most interesting learnings in biochemistry?
A: Biochemistry, often known as biological chemistry, is the study of chemical processes inside and rel...
Streptococcus pneumoniae cells of genotype str
s mtl
- are
transformed by donor DNA of genotype strr
mtl+ and (in
a separate experiment) by a mixture of two DNAs with
genotypes strr mtl
- and str
s mtl+. The accompanying
table shows the results.a. What does the first row of the table tell you? Why?
b. What does the second row of the table tell you? Why?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .The transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505Calculate these for 1 ug of plasmid DNA in a final total volume of 20 ul. All enzymes being used here are at a concentration of 10 U/µL. For double digests, give the appropriate volume for each enzyme and decide which buffer to use. (HINT: look up double digest conditions on the NEB website.) You should always calculate all volumes in advance to ensure the correct working concentrations and so that you can prepare the digests as efficiently as possible. It is a good idea to check off each component as it is added to the microfuge tube. Complete the table below, including the volume of DNA sample(s) you will need for 1 pg of the DNA (from two different methods in Experiment #3) based on the concentration(s) you determined from the OD260 value, which you will restriction digest with each of the restriction enzymes singly and in double digests in Part A. For example, the volume of DNA sample that contains 1 µg DNA for DNA sample from Part A, Experiment 3: OD260 = 0.024, dilution 500x…
- DNA-Neoantigen Coupling FAM Peptide (Pep) Br- R.T., 12 h M «S- X Pep-sulf FAM HS ssDNA 4°C, 2 h, pH 9.6 M + FAM DNA-peptide conjugateMLB 153 Tutorial 9 1. Pro. A wild-type strain of bacteria produces a protein with the amino acid proline (Pro) at one site. Treatment with nitrous acid causes a C to change to a U. Two different mutants are produced after nitrous acid treatment of the bacteria. One has a serine (Ser) in place of the proline, an the other has a leucine (Leu). Further treatment of the two mutants with nitrous acid produces new mutant strains, both with phenylalanine (Phe) at the site. Treatment of the phenylalanine carrying mutants produces no change. U b Ser Leu Phe—>Phe C UUU UUC ULA UUG CUU CUC CUA CUG Lau AUU AUC AUA AUG Met BED GUU GUC GGUA GUG Val C UCU UCC UCA UCG CCU ccc CCA CCG ACU ACC ACA ACC Thursday 18 May 2023 OCU GCC GCA GCG The A UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG Tyr Gin Aan GAU GAC Asp GAA Glu GAG G vou cys UGC UGA Stop UGG Trp COU COC CGA SENA COG AGU AGA GGU GOC GGA GGG Ser a. Use appropriate codons to show how these mutations occurred. Assume only a single nucleotide…#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…10 minutes left Assume that an organism has 400 V and 10 J light chain gene segments and 400V, 10 D, and 10 J heavy chain segments in its haploid genome. If no nucleotides are lost or gained during recombination within the heavy and light chain DNA, how many functional immunoglobulin light chain genes and heavy chain genes theoretically could be generated in this organism?. Do in 15 min atleast.a- https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5866609/pdf/pnas.201800195.pdfb- (Article is no longer available) Here are the articles provided within the question - They are not needed but are available if additional information is warranted - The figures being mentioned are already provided. This is Biochemoistry, please answer each part to the best of your ability. There are a max of 3 parts due to guidelines and please answer each part with clear and efficient work with answers. Thank you
- 1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why the method would not take place under the conditions described . 1. Which method of DNA transfer between bacteria would not take place if the donor and recipient were separated by a filter with a pore size of 0.45 um or another physical barrier 2. Which method of transfer would be blocked by the presence of high concentrations of DNAase ( enzymes capable of degrading DNA ) ?Explain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and T4 DNA ligase.