You have purified a protein with that is comprised of 600 amino acids. How long (in nucleotides) is the mRNA transcript from start codon to stop codon? Group of answer choices 200 bases 600 bases 1200 bases 1800 bases

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: how many codons would exist in a genetic code that was four bases long (instead of three)

A: DNA consists of four different bases, and the codon is four bases long. So, there will. be 44 number…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which enzymes are involved in protein translation? There are multiple answers. Helicase DNA…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: You are designing an experiment where you are doing a point mutation changing an aspartate residue…

A: Merrifield synthesis, it work with solid phase peptide .  it help in research of chemistry and…

Q: Now we need to know which amino acid the tRNA is carrying. We can do this on paper using the…

A: Strand mRNA codon tRNA anti-codon AA(short) AA(full name) Strand1: C-G-T-T-A-T-C-T-C-A-T-A-G-C-T…

Q: Complete the following chart. Region Length Multiples of 3?

A: RNA is abbreviated as ribonucleic acid and it is composed of a ribose sugar, which is attached with…

Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…

A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…

Q: Why is specific base pairing essential to the processes of transcription and translation? - How many…

A: The DNA is composed of sugar and phosphate that serves as the backbone, and at each sugar, a…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: Suppose you are analyzing a nucleic acid sequence which contains guanine, cytosine, adenines, and…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…

Q: Choose the correct answer from the list. is a DNA binding site. protects coding sequences at the 5'…

A: All these terms are related to synthesis of biomolecules by the processes such as transcription and…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Separate the following strand into codons: UGAAUUAUCGCG Your answer

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: plain the steps of translation. Include all molecules involved in the process and their role in the…

A: Every cell has a nucleus that houses genetic material, DNA.  Genes are the segments of…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four…

A: Palindromic DNA sequences are read the same on both DNA strands from the similar end. For example,…

Q: The role of iodine in the Carruthers/Letsinger method of solid-phase DNA synthesis is to act as…

A: Letsinger in 1960's targeted oligonucleotide synthesis using solid phase chemistry. Solid phase…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: Sequence A: 37 TCT/TCC/CTC/CTA/AAC/GTT/CAA/CCG/GTT/CTT/AAT/…

A: To identify the middle, end, and beginning sequences, we need to analyze the mRNA sequences and look…

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: Experiments have demonstrated that the "words" of the genetic code (the units that specify amino…

A: The genetic code is a set of rules that specifies how the information in DNA and RNA molecules is…

Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…

A: Ans- Tyrosine was replaced with cysteine.

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: Complete the table below: DNA DNA Complimentary Strand  mRNA sequence  tRNA sequence  Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation.  The…

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines…

A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve first three…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: The mass of RNA that has copied a segment of DNA is 63,000 units. The RNA mass that is placed in the…

A: Here, first we have to calculate the RNA units that will be used for peptide synthesis  so, 60% 0f…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: Use the DNA sequence above, list all possible splicing products

A: Splicing, is a form of RNA processing in which a pre- mRNA transcript is transformed into a mRNA.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.