The first column of the table below shows the beginning of a gene and five different mutations of this part of the gene. Use the base-pairing rules to complete the second column. For each mutation, result of the mutation and use "X" marks to write in any mRNA codons that will be changed as indicate codons that will not be changed. Use the codon wheel on page 10.11 to identify any stop codons in the mRNA molecules. Circle the stop codons. Use the codon wheel to complete the last column. For each mutation, write in any amino acids that will be changed and use "X" marks to indicate any amino acids that will not be changed. Use dashes to indicate any amino acids that will be missing as a result of a stop codon. First five mRNA codons Beginning of Protein Beginning of gene in DNA Original DNA = TACGCAAGTACCTGA... AUG CGU UCA Met - Arg - Ser – Trp - Thr UGG ACU Mutation 1 = TACGCCAGTACCTGA... (nucleotide change underlined) Mutation 2 = TACGCACGTACCTGA... (nucleotide change underlined) Mutation 3 = TACGCAAGTACTTGA... (nucleotide change underlined) Mutation 4 = TACGAAGTACCTGA... (second C deleted) Mutation 5 TACGCAAGTACTGA.. (third C deleted)

The first column of the table below shows the beginning of a gene and five different mutations of this part of the gene. Use the base-pairing rules to complete the second column. For each mutation, result of the mutation and use "X" marks to write in any mRNA codons that will be changed as indicate codons that will not be changed. Use the codon wheel on page 10.11 to identify any stop codons in the mRNA molecules. Circle the stop codons. Use the codon wheel to complete the last column. For each mutation, write in any amino acids that will be changed and use "X" marks to indicate any amino acids that will not be changed. Use dashes to indicate any amino acids that will be missing as a result of a stop codon. First five mRNA codons Beginning of Protein Beginning of gene in DNA Original DNA = TACGCAAGTACCTGA... AUG CGU UCA Met - Arg - Ser – Trp - Thr UGG ACU Mutation 1 = TACGCCAGTACCTGA... (nucleotide change underlined) Mutation 2 = TACGCACGTACCTGA... (nucleotide change underlined) Mutation 3 = TACGCAAGTACTTGA... (nucleotide change underlined) Mutation 4 = TACGAAGTACCTGA... (second C deleted) Mutation 5 TACGCAAGTACTGA.. (third C deleted)

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.
Choose a pentapeptied composed of five different amino acids. List the five amino acids. Present the messenger RNA codons for the amino acids and the sequence of the nucleotids on the DNA that was originally coded for the pentapeptide.
The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASE
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: Check
The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"
Help me please
A nonsense mutation is a substitution mutation that creates a chain-terminating codon in the mRNA corresponding to the mutant gene. Identify three substitution mutations that could change a tryptophan codon to a nonsense triplet.
Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart on the next page to answer the following questions. Partial gene sequence of DNA nucleotides: A C C T T A A T G A A C T C T 42. What is the mRNA nucleotide sequence that would result from transcription of the partial gene sequence of DNA nucleotides? 43. What is the protein amino acid sequence resulting from translation of the mRNA sequence from the previous question? 44. In the gene sequence of DNA nucleotides, guanine (G) is mistakenly replaced by adenine (A) during DNA replication. What type of mutation would this be considered based on how it occurred? ________ a) spontaneous b) gametic c) mutagenic d) carcinogenic 45. Consider the mutation from the previous question. If it occurred within a skin cell of the body, what type of mutation would this also be considered based on where it occurred? ________ a) gametic b) germline c) heritable d) somatic