Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your transcription and look for the stop codon to end it. Highlight both the START and STOP codons:   DNA G C T A C G G A A T T C mRNA

Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||

For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G

TAC/ACC/GAC/GAA/AAT/TGT/TAC/CGT/TCA/AAC    asap please

Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a ribosome comes to one of these codons?

Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'

Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTA

Please fill out 2nd and 3rd rows using the instrxutions listed above. EVERYTHING.

Complete the box below:     Convert the following template strand of DNA bases into its complementary mRNA molecule.  Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATT