In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. DNA T-A-C A-A-G A-T-G G-G-G A-T-T mRNA Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Amino acid Enter Text Enter Text Enter Text Enter Text Enter Text

In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. DNA T-A-C A-A-G A-T-G G-G-G A-T-T mRNA Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Amino acid Enter Text Enter Text Enter Text Enter Text Enter Text

Medical Terminology for Health Professions, Spiral bound Version (MindTap Course List)

8th Edition

ISBN:9781305634350

Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Chapter7: The Respiratory System

Section: Chapter Questions

Problem 41LE

See similar textbooks

Similar questions

Write the CODON that corresponds with each amino acid. There may be more than one. The full names are written, but the codon chart only shows the first three letters. glycine ______________________ phenylalanine ______________________ arginine ______________________
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTC. Then list in order the amino acids coded by this sequence: mRNA ________________________________________________________________ Amino acids _____________________________________________________________
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Amino acid spelling must match the spelling in the above table.
DNAT A C C G C C C C A T G A T G A A T A C C G G G A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
The line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or structures that may or may not be a part of mature eukaryotic mRNA. As accurately as you can, show the location, on the line, of the sequences or structures that belong on the eukaryotic mRNA; then separately list the items that are not part of eukaryotic mature mRNA. 5’____________________________________________________3’ A-stop codon B-poly-A tail C- intron D- 3’UTR E-promoter F- start codon G- AAUAAA H- 5’ UTR I- 5’ cap J- Termination sequence
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"
Transcribe the strand into MRNA: TCA-TCA-CAG-GAT Your answer
Transcribe the strand into mRNA: GCA-AGG-TAT-CGT Your answer
Highlight or underline or bold both the start and stop codons asap
This molecule: -is involved in translation -may bind to the “start” codon on mRNA -has an amino acid attachment site at one end -has an anticodon at the other end ______

SEE MORE QUESTIONS

Recommended textbooks for you

Medical Terminology for Health Professions, Spira…

Health & Nutrition

ISBN:

9781305634350

Author:

Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:

Cengage Learning

Medical Terminology for Health Professions, Spira…

Health & Nutrition

ISBN:

9781305634350

Author:

Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

GET THE APP

About FAQ Academic Integrity Sitemap Document Sitemap

Contact Bartleby Contact Research (Essays)High School Textbooks Literature Guides Concept Explainers by Subject Essay Help Mobile App

GET THE APP

Privacy

Your CA Privacy Rights

Your NV Privacy Rights

About Ads

Manage My Data

bartleby, a Learneo, Inc. business

DNA	T-A-C	A-A-G	A-T-G	G-G-G	A-T-T
mRNA	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text
Amino acid	Enter Text	Enter Text	Enter Text	Enter Text	Enter Text