protein. How would the protein produced from sequence #1 differ from the protein produced from sequence 2? Discuss the actual protein you produced in sequence #1 vs sequence #2. What are the potential repercussions for protein protein #2 and therefore the biopathways that require that protein?

5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 --+---- 70 3′-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTCACATTACAAACGGATTCCGG -5' 1 11 -#- -+-- +-- a) Draw a green box around the promoter. b) Label the template strand of the DNA on the sequence above. --+-- -+ c) Write the sequence of the pre-mRNA. d) This gene has a small intron and the intron splice sites has the composition 5'-GUG-3' (for the 5' splice site) and 5'-UUG-3' (for the 3' splice site), meaning that these sequences and everything between them will be removed from the mature mRNA. -Draw a box around the intron on the DNA sequence above. e) Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. f) Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?

61 identify the primer 3' 5' a 5' 3' C e f a 5' 3' 3' 5' Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a b b e f a Save Unanswered

Name and explain the three possible consequences of having a mutation somewhere in the region from 61-75.