Which of the following could be the DNA template for the following protein primary structum Methionine - Alanine Asparagine Aspartic Acid - Phenylalanine Glutamine - stop O a. 3' TACCGGTTACTGAAAGTTATT 5' O b. 3' AUGGCCAAUGACUUUCAAUAA 5' O c. 5' ATGGCCAATGACTTTCAATAA 3' O d. 5' TACATGTAACAAGACGCCAAT 3'

Q: 63. A student studying mutations found her amino acid chain was…

A: Genetic information is carried by genes to make proteins .  Process includes:-  I ) Transcription II…

Q: GCA UGC CGA UAC

A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: Answer: Central Dogma : It is the complete process of replication of DNA,  transcription of DNA to…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…

A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: Which of the following RNA molecules is to the sequence: 5' AGGCTCAAGCGT - 3'? complementary O a.…

A: RNA is a single stranded nucleic acid which plays a key role in gene expression and protein…

Q: Below is a sequence of mRNA. Use it to answer the questions below. 5' -…

A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…

Q: 2' HO 5' OH-3' -OH-3 |3' M O A represents Group I introns and B represents spliceosome introns O A…

A: Here,the answer is A represents Group II introns and B represents Group I introns. Group I and Group…

Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…

A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: Consider the translation of the following mRNA base sequence below during protein synthesis and…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: The following picture drawing represents co-translation in E. coli. Answer the questions below the…

A: The question is to analyse the picture and answer the questions accordingly. Let's move on to the…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: RNA polymerase subunits comprising the core enzyme are a.α b.β c.δ d.σ e.ω

A: RNA POLYMERASE It is a multi-subunit enzyme. It is composed of five subunits…

Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…

A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…

Q: A portion of an unknown enzyme has the amino acid sequence serine phenylalanine - glutamate -…

A: Gene is the sequence of nucleotides that encode a specific protein.

Q: What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDEL…

A: Introduction N-linked Glycosylation (NLG) Is A Complicated Biosynthetic Process That Controls…

Q: The following protein sequence was made. N-MET TYR GLN GLN CYS-C a. Using the top most option from…

A: Introduction Amino acids are chemical molecules that combine to produce proteins; hence, they are…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: In bacteria which ribozyme catalyzes synthesis of peptide bonds between amino acids? 16S rRNA 5S…

A: the translation is the process by which the messenger rna is converted into polypeptide .

Q: In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n) acid and the CCA sequence…

A: The translation is the process by which proteins are synthesized from mRNA through a sequence of…

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: Which letter in the diagram below is pointing to the anticodon

A: A trinucleotide sequence that is complementary to a corresponding codon in a messenger RNA sequence…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine

A: Hydrophilic amino acids are those acids which are highly stable when present in water. They are…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: You are given the following template strand of DNA: 5'-CGATTGCGATTGGGCATGG-3' A. Transcribe this…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides that join together via a 3'-5'…

Q: This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the…

A: In order to provide good quality answers and keep with the site regulations, the first three parts…

Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’   a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C  5 ’…

A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…

Q: The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small…

A: Translation is a method or process by which the message on the messenger RNA is converted into a…

Q: 5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help…

A: A. The polypeptide generated by the given RNA sequence is "Met-Pro-Thr-Asp-Trp-Pro."b. The mutation…

Q: What is the function of:  D loop - Anticodon Loop-  TC Loop-  acceptor stem-

A: The term tRNA stands for transfer RNA. tRNAs are small, generally having less than 100 nucleotides.…