Which of the following could be the DNA template for the following protein primary structum Methionine - Alanine Asparagine Aspartic Acid - Phenylalanine Glutamine - stop O a. 3' TACCGGTTACTGAAAGTTATT 5' O b. 3' AUGGCCAAUGACUUUCAAUAA 5' O c. 5' ATGGCCAATGACTTTCAATAA 3' O d. 5' TACATGTAACAAGACGCCAAT 3'

Q: 63. A student studying mutations found her amino acid chain was…

A: Genetic information is carried by genes to make proteins .  Process includes:-  I ) Transcription II…

Q: GCA UGC CGA UAC

A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC

Q: Chaperones are: please explain the answer  a.proteins that promote proper amino acid incorporation…

A: Proteins are a class of complex nitrogenous organic compounds, composed of amino acid residues…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: A). What is the amino acid sequence of the polypeptide produced from a eukaryotic gene that has the…

A: Transcription  The process on making mRNA from DNA which further get translated into polypeptide…

Q: Which of the following RNA molecules is to the sequence: 5' AGGCTCAAGCGT - 3'? complementary O a.…

A: RNA is a single stranded nucleic acid which plays a key role in gene expression and protein…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: A В Asparagine D. Methionine A AG E G F

A:

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: Would the cell likely experience an issue due to the incorrect function of the protein produced by…

A: DNA ( deoxyribonucleic and) is a genetic material in most of the organism that appear as two…

Q: On which of the following amino acids is an N-linked glycan added to? A.Asparatic acids…

A: Basic amino groups (-NH2) and carboxyl groups (-COOH) are found in amino acids. Proteins have amino…

Q: RNA polymerase subunits comprising the core enzyme are a.α b.β c.δ d.σ e.ω

A: RNA POLYMERASE It is a multi-subunit enzyme. It is composed of five subunits…

Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…

A: DNA is the store house of genetic information. This information is in the form of nucleotide…

Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…

A: Gene expression is the process by which the instruction in the DNA is converted to products through…

Q: A portion of an unknown enzyme has the amino acid sequence serine phenylalanine - glutamate -…

A: Gene is the sequence of nucleotides that encode a specific protein.

Q: What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDEL…

A: Introduction N-linked Glycosylation (NLG) Is A Complicated Biosynthetic Process That Controls…

Q: The following protein sequence was made. N-MET TYR GLN GLN CYS-C a. Using the top most option from…

A: Introduction Amino acids are chemical molecules that combine to produce proteins; hence, they are…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: The following picture drawing represents co-translation in E. coli. Answer the questions: A. Which…

A: Using the signal recognition particle (SRP), the co-translational route transports secretory…

Q: In bacteria which ribozyme catalyzes synthesis of peptide bonds between amino acids? 16S rRNA 5S…

A: the translation is the process by which the messenger rna is converted into polypeptide .

Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…

A:

Q: In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n) acid and the CCA sequence…

A: The translation is the process by which proteins are synthesized from mRNA through a sequence of…

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.…

A:

Q: These tRNAs line up along an mRNA in this order; what is the protein they will produce? 5'-ACA…

A: The process of synthesising proteins is known as translation. Codons are the trinucleotide bases…

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: You are given the following template strand of DNA: 5'-CGATTGCGATTGGGCATGG-3' A. Transcribe this…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides that join together via a 3'-5'…

Q: This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the…

A: In order to provide good quality answers and keep with the site regulations, the first three parts…

Q: Which of the following RNA has a catalytic activity like an enzyme? A. mRNA C. rRNA B. tRNA D.…

A: RNA is ribonucleic acid which consists of ribose sugar, nitrogen base and a phosphate group.This is…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…

Q: Order the following choices to indicate the sequence of steps in the process of elongation of a…

A: The following are necessary for prokaryote polypeptide synthesis to begin: mRNA, the 30S ribosome…

Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…

A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’   a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: 20. The image above reveals two bacterial cells in the process of A. cell lysis B. transduction C.…

A: In the image given for MCQ (20), the two bacterial cells are under the process of "Conjugation".…

Q: The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small…

A: Translation is a method or process by which the message on the messenger RNA is converted into a…

Q: What is the function of:  D loop - Anticodon Loop-  TC Loop-  acceptor stem-

A: The term tRNA stands for transfer RNA. tRNAs are small, generally having less than 100 nucleotides.…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: One of the initial steps in gene expression is transcription. Only one DNA strand, known as the…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA  is as follows_  3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: Which two amino acids may be encoded in genes by stop codons? OA. L-Hydroxyproline and…

A: The genetic code is universal and every individual amino acid is coded by a triplet codon. The…