Which of the following could be the DNA template for the following protein primary structum Methionine - Alanine Asparagine Aspartic Acid - Phenylalanine Glutamine - stop O a. 3' TACCGGTTACTGAAAGTTATT 5' O b. 3' AUGGCCAAUGACUUUCAAUAA 5' O c. 5' ATGGCCAATGACTTTCAATAA 3' O d. 5' TACATGTAACAAGACGCCAAT 3'

a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of impact will this mutation have on the functionality of the protein? Second Letter UUU UUC UUA JUG UCu uCC UCA UCG UAU UAC UGU UOC Phe Tyr Cys Ser UAA Stop UGA Stop UAG Stop UGG Trp Leu cu cc Pro CUU COU CAU His CAC CUC CUA Leu Arg CCA Cca CGA CUG CAA Cin CAG AGU AGC AGA Arg AAU AUU AUC le AUA AUG Met ACO ACU ACC ACA Asn Ser AAC The MA AAG Lys AGG CAL KAC GUU Aep GUC Val CUA OCC Ala OCA GA Clu GAG Oly GOA GUG GGG Original DNA strand G AC 1. G. G. Mutated DNA strand GA Third letter

UCAGUCAGUOPODOTO E GFL A Alanine GU STOP Tyrosine A Stop C STOP V A Valine GU Cysteine G Stop G Tryplophan Arginine G A C A U Leucine Serine A UG Lysine Proline Asparagine GACUGACU H. MIR START Glycine Serine Leucine Glutamic Phenyl acid Aspartie acid Histidine RSK Glutamine Arginine Methionine Isoleucine Threonine

Can you explain the answer and how to find it ? Number 1

please answer E and F  asap please

Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the two G nucleotides in the sequence 5’-GGATCC-3’, on both top and bottom strands).

Consider this sequence below:  GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGA

Label the following regions on this tRNA molecule, stating the function of each:

If the anticodon on the tRNA is 3' GCC 5' , the amino acid added by tRNA synthetase will be? 1. P  2. R 3.A 4.G

Given the following RNA molecule: 5' -CUUCAGCAC- 3' a. What amino acid sequence is coded for by this molecule? b. What is the amino acid sequence if a mutation converts CAC to AAC f. What occurs when a mutation converts CAG to UAG?