Answered: A DNA antisense strand contains the…

Name: A DNA antisense strand contains thefollowing nucleotide base sequence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A DNA antisense strand contains thefollowing nucleotide base sequence:ACG TTT ATG GGTFrom this, what is the nucleotide sequenceof the MRNA strand that is transcribed?a. TGC AAA TAC CCAb. UGC AAA UAC CCAC. AGC UUU AUC CCUd. ACG UUU AUG GGU

Science

Biology

A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this, what is the nucleotide sequence of the mRNA strand that is transcribed?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2SQ

See similar textbooks

Similar questions

Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAA
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
thank you
2) Create an MRNA strand based on the given DNA template strand: TACTT CCTATTITCT IGTCA CCGCACT
Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct Transcript c. Transcript for Translation d. Amino Acid Sequence or Translation:
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this, what is the nucleotide sequence of the MRNA strand that is transcribed? a. ATC CAA GÁC TGG b. TAG GTT CTG ACC c. UAG GUU CUG ACC d. AUC CAA GÁC UGG