Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C. MRDMW-

Q: 67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the…

A:

Q: Which enzyme in the table doesn’t generate cohesive ends after cutting? Select one: a. BamHI b.…

A: Restriction enzymes are proteins that cut DNA at specific sequences. These enzymes are found in…

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: Alternative splicing a. increases the number of proteins made from one gene b. increases the number…

A: in alternative splicing there is a selection of different types of sites of splicing which can…

Q: A deletion mutation occuring in the region of DNA which encodes for a sigma subunit of RNA…

A: Mutation is sudden, heritable change in the sequence of the genome that give rise to alternate form…

Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…

A: Need to find the mature mRNA in above options

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: 24. TRUE or FALSE: A microRNA (in red) binds to its mRNA target (black) as shown below:…

A: False  The target will be cleaved.

Q: A particular mature miRNA (microRNA) in mice has sequence 5'-UUCCCUGAGACCUCAAGUGUGA-3'. a. If you…

A: Answer a) ii and iii ii) mRNA sequence complementary to the miRNA sequence iii) miRNA sequence with…

Q: a. The promoter is to the right so transcription goes right to left. b. This sequence 5’…

A: Transcription is is a cellular process by which DNA can produce RNA by the use of RNA polymerase…

Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: You are interested in the rapid mutation rate of the polymerase of a virus XY, that inserts its…

A: The mutation changes the amino acid at the third position. Specifically, it changed from Glycine…

Q: . How many codons are there above in question 8? Label one of them in green.

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named…

A: Understanding the genetic processes that take place in cells requires a thorough understanding of…

Q: Dystrophin gene structe 3 T Elijah's X G Promoter Exon 19 Exon 52 Intron Exon 53 T Liam's X affected…

A: The gene is the sequence of nucleotide that encode a particular protein.

Q: WHAT ARE THE RISKS OF HUMAN FUNGAL PATHOGEN?

A: We ha e different types of organisms in our environment. Bacteria virus and fungi some of the…

Q: B. Both involve binding of rho, but rho-independent termination requires conformational change on…

A: After binding to the newly formed RNA chain, ρ factor moves along the molecule in a 5'-3' direction…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…

A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…

Q: 55 __________________ assemble to form a spliceosome, the splicing machine that excises introns. A.…

A: Introduction Transcription is a process where mRNA is produced from DNA. After transcription mRNA…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Select the events from eukaryotic transcription from the list below and list them below in order, by…

A: What is transcription? Transcription is the process where RNA is synthesized from DNA by the…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: a. promoter region b. RNA polymerase C. antisense strand d. poly-A tail e. 5' cap f. splicing 8.…

A: Introduction :- A promoter is a DNA region where RNA polymerase starts transcription of a gene.…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates…

A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript)…

Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…

A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…

Q: The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA…

A: Template strand runs in the direction 3' 5' end and non template runs in the direction 5' 3'. mRNA…

Q: Match these transcription-associated terms with the appropriate definition or function. DNA sequence…

A: The transcription of DNA occurs in 3 major steps, initiation, elongation and termination. The…

Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…

A: Molecular biology is the study of biological processes at molecular level. It includes various…

Q: Which of the following is NOT a true statement about the 5' cap? O A. The Cap Binding Complex (CBC)…

A: The five-prime cap (5′ cap) is a specially altered nucleotide on the 5' end of some primary…

Q: Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation.…

A: Answer :- 1. UGU (Cys) is converted to UGC (Cys) - silent mutation

Q: Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes…

A: RNA Polymerase II is responsible for the transcription of messenger RNA with the help of DNA. For…

Q: (a) Match the following list of RNAS (left side) with their function(s) (right side). w. MRNA X.…

A: The study of molecular biology has led to the discovery of various smaller molecules of RNA which…

Q: C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label…

A: Genes are the hereditary unit of an organism. It is inherited by the progeny from the parental…

Q: Given this viral mRNA, which model represents the correct (+)ssRNA genome from which it was made?…

A: mRNA or messenger RNA contains genetic codons that is being translated into polypeptide chain during…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.