Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C. MRDMW-

Define (whether post-transcriptional, post-translational, transcription) and describe the regulation of the Ferretin mRNA in the diagram below.

please help with question a bit confusing

. Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a. 5’-CGATCTAATG-3’ b. 3’-TGCCGAGCTA-5’ c. 3’-GTAATCTAGC-5’ d. 3’-CATTAGATCG-5’ Coupling of transcription and translation is found where? near type II RNA polymerase activity in prokaryotic cells within the eukaryotic nucleus at the ribosomal complex pls answer

Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Resulting Amino Acid Row A B D. OC. C D. D C Select one: OA A OB B Mutated DNA ATG ATG ACT ACT Metabolic syndrome is a genetic disorder with symptoms such as hypertension, elevated blood cholesterol, and low blood magnesium concentrations. This syndrome is caused by a mutation in which a cytosine nucleotide in the codon ACG is replaced by a thymine nucleotide. Use the following to answer the next AUG UAC ACU UGA Methionine Tyrosine Threonine Stop

To start transcription, RNA polymerase binds to a please explain your answer  a.initiator complex b.promoter sequence c.trigger factor d.Rho factor e.Shine-Dalgarno sequence

K F3 : 3 E D с WE Which letter indicates a codon? F4 $ 4 A Q Search R F mRNA F5 40-00 % 5 UAC (Met Gly T G GGG AUGCCCACG F6 A 6 V B 20 Y F7 H & 7 1 7 F8 U 4 144 * 00 8 99+ J 1 UAG 8 $325 F9 1 5 ( 9 Alt N Мо G F10 9 K 2 O < 6 ) 0 F11 1 P* L 3 A. - 1 F12 ^03 ; { [ Ctrl = 11 ? + 1 5:32 PM 4/7/2023 1 Backspace ← Home Delete Enter Shift PgUp PgDn .

RNAi (or RNA interference) is the process of creating double-stranded RNA in the cells. Explain how  this strategy can be effective against COVID19 and describe how you would go about doing this generally.

Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…

Choose the item in column 2 that best matches each item in column 1. A. Provides information for production of protein B. Binds to promoter C. Promoter has a box A and box B consensus sequences D. Autocatalytic RNA molecules E. Associated with transcription termination F. Polymerization of ribonucleotides to form RNA molecules G. 7-methyl guanosine H. MRNA prior to processing select - 1. Core RNA polymerase select 2. rho (p) factor select 3. hnRNA select - 4. RNA select -5. RNA polymerase holoenzyme select 6. Ribozymes select - 7. 5' MRNA cap select 8. MRNA