Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the two G nucleotides in the sequence 5’-GGATCC-3’, on both top and bottom strands).

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .…

A: DNA, short for deoxyribonucleic acid, is a nucleic acid molecule made up of a sugar called…

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…

A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…

Q: Write the complementary strand for each of the following strands of DNA. Part 1 of 4 5'-TTCGAAAA-3'…

A: Important information:DNA consists of two complementary strands that run in opposite directions…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: Express the following DNA nucleotide bases into amino acids.

A: DNA is first transcribed into mRNA and then translated to amino acids.  In transcription, it follows…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.  The alpha…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…

A: DNA serves as the genetic material and carries genetic information from one generation to another.…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain

A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…

Q: 1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: DNA is a deoxyribonucleic acid. It is the double helical molecule which carries genetic information…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: Given the following coding sequence for DNA, provide the sequence of the complementary(template)…

A: A nucleotide is a biomolecule that consists of a nitrogenous base (either a purine or a pyrimidine),…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…

A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…

Q: What would be the percentage of G, C, A, and T in each column? Have to calculate the nucleotide…

A: Nucleotide frequency is the percentage of each nucleotide (G, C, A, and T) in a DNA or RNA sequence.…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: A DNA fragment with the following base sequence has some cytosine bases that are methylated…

A: The bisulfate sequencing is the treatment of DAN with bisulfite before the routine sequencing for…

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: draw the structure of the polynucleotide GT

A:

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…

Q: In the laboratory a team of peptide/protein chemists synthesize the HIV-1 protease from all…

A: According to the mirror symmetry, the corresponding D-peptide, as the enantiomer of that specific…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: Escherichia coli DNA sequence that cc

A:

Q: Metenkephalin is a small peptide found in animal brains that has morphine-like properties. Give an…

A: DNA is transcribed into mRNA. The mRNA contains a tripeptide sequence known as codons that code for…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…