Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the two G nucleotides in the sequence 5’-GGATCC-3’, on both top and bottom strands).

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…

A: Introduction :  The translated form of the DNA sequence is the amino acid sequence. The DNA sequence…

Q: Express the following DNA nucleotide bases into amino acids.

A: DNA is first transcribed into mRNA and then translated to amino acids.  In transcription, it follows…

Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…

A: DNA serves as the genetic material and carries genetic information from one generation to another.…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write…

A: The coding strand is complementary to the template strand.  The template strand is the DNA sequence…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain

A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: 1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: DNA is a deoxyribonucleic acid. It is the double helical molecule which carries genetic information…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Wild type sequence : Met Ser Pro Arg Leu Glu Gly    Mutant 1: Met Ser Pro   After pro, the peptide…

Q: In the following gel showing stained bands of the Alu insertion sequence, what is the gem of…

A: In the gel, the presence of a band at 941 bp indicates the presence of the Alu insertion sequence,…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…

A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Q: Given the following coding sequence for DNA, provide the sequence of the complementary(template)…

A: A nucleotide is a biomolecule that consists of a nitrogenous base (either a purine or a pyrimidine),…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…

Q: 5 to 3 direction, the DNA template strand should be  5'TTT-GGG-AAA-3'

A: mRNA and DNA are two types of nucleic acids that play crucial roles in gene expression and protein…

Q: Which strand was used for the following old amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: By the process of transcription mRNA is produced from the DNA. the transcription process occurs…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: ANSWER;-

Q: You have been given an unknown low weight polypeptide to sequence. Luckily, you have a plentiful…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…

Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…

A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…

Q: What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using…

A: Gene expression is the process through which the genetic codes of a gene, the nucleotide sequence,…

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…

A: During transcription process, the strand used as template is known as template strand which sets in…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…