t Differentiate eukaryotic translation from prokaryotic translation by completing the table below. Prokaryotes Eukaryotes Sizes of ribosomal units First methionine (formylated or not) Proteins involved in initiation Proteins involved in termination Translation occurs even if transcription is still taking place (Yes or No) Initiation sequence upstream of the start codon

t Differentiate eukaryotic translation from prokaryotic translation by completing the table below. Prokaryotes Eukaryotes Sizes of ribosomal units First methionine (formylated or not) Proteins involved in initiation Proteins involved in termination Translation occurs even if transcription is still taking place (Yes or No) Initiation sequence upstream of the start codon

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

During translation elongation cycle, which of the following step(s) is/are repeated for each amino acid in polypeptide synthesis? Select all that apply. You may select multiple options. Opeptide bond formation O Ribosome scanning for initiation codon AUG O binding of second aminocyl-tRNA Otranslocation
Compare prokaryotic and eukaryotic translation initiation with respect todelivering an initiator tRNA to the ribosome and locating the initiation codon.
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAifMet
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAi fMet
Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis, from first to last.30S initiation complex70S initation complexElongation Factor TuElongation Factor GInitiation Factor 3Release Factor 1fMet-TRNA fMet
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
es/2015347/quizzes/5825805/take The "factory" itself, made of two [Choose] subunits [Choose ] FRNA The site from which the growing polypeptide chain exits the ribosome RELEASE FACTOR CODON RIBOSOME P SITE The processed copy of DNA that UGA carries its sequence of codons to the TRNA ribosome AUG ANTICODON MRNA The carriers of each unique amino acid E-SITE to A-site of the ribosome The three letter message carried to [ Choose ] the ribosome on the "toes" of the TRNA The site from which the now empty [ Choose ] TRNA leaves the ribosome The first codon required to initiate [ Choose ] translation (on the mRNA). The binding chemical that comes along once the STOP codon is encountered: disassembles the ribosomal complex [Choosc] hp
Insert Table Chart Text Shape Media Comment Which of the following statements regarding "start" and "stop" signals apply to both transcription and translation? the start and stop signals are "read" (i.e., interpreted) the start and stop signals reside within nucleic acid the start and stop signals are part of the genetic code the start and stop signals reside in RNA. start and stop signals are needed because the products must have a definite length and sequence.